Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 98 showing 1941 ~ 1960 out of 2,177 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/196868

Species: Rattus norvegicus
Genetic Insert: PACT-mOrange2-hCM1
Vector Backbone Description: Backbone Size:6972; Vector Backbone:pBeta-actin-Nedd1-mOrange2-hCM1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36796357

Proper citation: RRID:Addgene_196868 Copy   


  • RRID:Addgene_196867

http://www.addgene.org/196867

Species: Rattus norvegicus
Genetic Insert: Akap9
Vector Backbone Description: Backbone Size:3519; Vector Backbone:pCR-XL-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36796357
Comments: For successful transformation of Plasmid 196867: pCR-XL-rAkap9, it is recommended to use electroporation and to grow transformed bacteria at no more than 28 °C for two days and with 30 μg/ml kanamycin on LB plates for full length plasmid production

Proper citation: RRID:Addgene_196867 Copy   


http://www.addgene.org/196861

Species: Rattus norvegicus
Genetic Insert: Nedd1-mOrange2-rCM1
Vector Backbone Description: Backbone Size:8089; Vector Backbone:pBeta-actin-Nedd1-mOrange2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36796357

Proper citation: RRID:Addgene_196861 Copy   


http://www.addgene.org/196860

Species: Rattus norvegicus
Genetic Insert: Nedd1-mOrange2
Vector Backbone Description: Backbone Size:6040; Vector Backbone:pBeta-actin-Tubg1-mEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36796357

Proper citation: RRID:Addgene_196860 Copy   


http://www.addgene.org/196862

Species: Rattus norvegicus
Genetic Insert: Nedd1-mOrange2-F75A
Vector Backbone Description: Backbone Size:8089; Vector Backbone:pBeta-actin-Nedd1-mOrange2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36796357

Proper citation: RRID:Addgene_196862 Copy   


  • RRID:Addgene_196871

    This resource has 1+ mentions.

http://www.addgene.org/196871

Species: Rattus norvegicus
Genetic Insert: AcGFP-Akap9 (128-425)
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pBeta-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36796357

Proper citation: RRID:Addgene_196871 Copy   


  • RRID:Addgene_184505

http://www.addgene.org/184505

Species: Rattus norvegicus
Genetic Insert: Synaptotagmin 4
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22398727
Comments: The first codon of the Synpatotagmin has been removed

Proper citation: RRID:Addgene_184505 Copy   


http://www.addgene.org/196859

Species: Rattus norvegicus
Genetic Insert: td-mCherry-Cdk5rap2
Vector Backbone Description: Backbone Size:7437; Vector Backbone:pBeta-actin-td-mCherry-CI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36796357

Proper citation: RRID:Addgene_196859 Copy   


http://www.addgene.org/196853

Species: Rattus norvegicus
Genetic Insert: AcGFP-Cdk5rap2-CTD
Vector Backbone Description: Backbone Size:6748; Vector Backbone:pBeta-actin-AcGFP-CI ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36796357

Proper citation: RRID:Addgene_196853 Copy   


  • RRID:Addgene_199152

http://www.addgene.org/199152

Species: Rattus norvegicus
Genetic Insert: enNTS1
Vector Backbone Description: Backbone Marker:Internal Lab Plasmid; Backbone Size:6112; Vector Backbone:pDS170; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36680775
Comments: For additional information, please refer to: Bumbak et al. 2018 "Optimization and 13CH3 methionine labeling of a signaling competent neurotensin receptor 1 variant for NMR studies" BBA Biomembranes. https://doi.org/10.1016/j.bbamem.2018.03.020 Bumbak et al. 2019 "Expression and Purification of a Functional E. coli 13CH3-Methionine-Labeled Thermostable Neurotensin Receptor 1 Variant for Solution NMR Studies" Methods Mol Biol. https://doi.org/10.1007/978-1-4939-9121-1_3

Proper citation: RRID:Addgene_199152 Copy   


  • RRID:Addgene_200083

    This resource has 1+ mentions.

http://www.addgene.org/200083

Species: Rattus norvegicus
Genetic Insert: Map1lc3b
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3900; Vector Backbone:pEGFPc/PGK; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37133994

Proper citation: RRID:Addgene_200083 Copy   


  • RRID:Addgene_197335

http://www.addgene.org/197335

Species: Rattus norvegicus
Genetic Insert: Shank3
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-Shank3 [N69/46R].

Proper citation: RRID:Addgene_197335 Copy   


http://www.addgene.org/176746

Species: Rattus norvegicus
Genetic Insert: HA-BioID2-BioID2-Kir4.1
Vector Backbone Description: Backbone Marker:Khakh lab; Backbone Size:5110; Vector Backbone:PZac2.1; Vector Types:Bacterial Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37046092

Proper citation: RRID:Addgene_176746 Copy   


  • RRID:Addgene_198174

http://www.addgene.org/198174

Species: Rattus norvegicus
Genetic Insert: AP-3 μ3A
Vector Backbone Description: Backbone Size:8117; Vector Backbone:pACT2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24229647

Proper citation: RRID:Addgene_198174 Copy   


  • RRID:Addgene_198179

http://www.addgene.org/198179

Species: Rattus norvegicus
Genetic Insert: AP-3 μ3A
Vector Backbone Description: Backbone Size:5474; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24831812
Comments: μ3A + linker + HA tag subcloned between EcoRI and SalI sites; double HA tag subcloned between SalI and NotI sites (SalI site destroyed)

Proper citation: RRID:Addgene_198179 Copy   


  • RRID:Addgene_197290

http://www.addgene.org/197290

Species: Rattus norvegicus
Genetic Insert: Pan-Neurofascin (extracellular)
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9562181
Comments: This is a validated antigen plasmid of Anti-Pan-Neurofascin (extracellular) [A12/18R]. Additional reference: https://pubmed.ncbi.nlm.nih.gov/10931875/.

Proper citation: RRID:Addgene_197290 Copy   


http://www.addgene.org/198860

Species: Rattus norvegicus
Genetic Insert: ND6-W82-L15 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG

Proper citation: RRID:Addgene_198860 Copy   


http://www.addgene.org/192317

Species: Rattus norvegicus
Genetic Insert: mCh-V5-NES-EGFP-Erbb2 NLS
Vector Backbone Description: Backbone Marker:Addgene #25752; Vector Backbone:pEN_TTmiRC2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37055441

Proper citation: RRID:Addgene_192317 Copy   


http://www.addgene.org/192339

Species: Rattus norvegicus
Genetic Insert: mCh-V5-NES-EGFP-Erbb2 NLS
Vector Backbone Description: Backbone Marker:Addgene #25736; Vector Backbone:pSLIK zeo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37055441

Proper citation: RRID:Addgene_192339 Copy   


  • RRID:Addgene_198200

    This resource has 1+ mentions.

http://www.addgene.org/198200

Species: Rattus norvegicus
Genetic Insert: Calmodulin 2
Vector Backbone Description: Backbone Size:5335; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37516972

Proper citation: RRID:Addgene_198200 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X