Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 99 showing 1961 ~ 1980 out of 2,177 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_197310

http://www.addgene.org/197310

Species: Rattus norvegicus
Genetic Insert: NavB4-GFP
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19228957
Comments: A V228L mutation was found in NavB4. This is a validated antigen plasmid of Anti-Navbeta4 Na+ channel [N168/6.3R].

Proper citation: RRID:Addgene_197310 Copy   


  • RRID:Addgene_197339

http://www.addgene.org/197339

Species: Rattus norvegicus
Genetic Insert: Neurexin 1beta
Vector Backbone Description: Backbone Marker:#58267 (alt); Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-Neurexin-1-Beta [N170A/1.1R].

Proper citation: RRID:Addgene_197339 Copy   


  • RRID:Addgene_206062

http://www.addgene.org/206062

Species: Rattus norvegicus
Genetic Insert: cacna2d1
Vector Backbone Description: Backbone Marker:Genetics Institute Inc; Backbone Size:5163; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33986433

Proper citation: RRID:Addgene_206062 Copy   


http://www.addgene.org/196879

Species: Rattus norvegicus
Genetic Insert: Nedd1-mOrange2-rCM1
Vector Backbone Description: Backbone Size:7664; Vector Backbone:pCAG-lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36796357

Proper citation: RRID:Addgene_196879 Copy   


  • RRID:Addgene_196565

http://www.addgene.org/196565

Species: Rattus norvegicus
Genetic Insert: GFP-alpha-CaMKII and MLS-NR2B
Vector Backbone Description: Backbone Marker:Clontech, USA; Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29966860

Proper citation: RRID:Addgene_196565 Copy   


  • RRID:Addgene_196945

http://www.addgene.org/196945

Species: Rattus norvegicus
Genetic Insert: Kv1.5
Vector Backbone Description: Vector Backbone:RBG4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-Kv1.5 K+ channel [K7/45R]

Proper citation: RRID:Addgene_196945 Copy   


  • RRID:Addgene_196941

    This resource has 1+ mentions.

http://www.addgene.org/196941

Species: Rattus norvegicus
Genetic Insert: Kv1.2
Vector Backbone Description: Vector Backbone:RBG4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-Kv1.2 K+ channel [K14/16R]

Proper citation: RRID:Addgene_196941 Copy   


  • RRID:Addgene_196951

http://www.addgene.org/196951

Species: Rattus norvegicus
Genetic Insert: mmp-9
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-MMP9 precursor [L51/82R]

Proper citation: RRID:Addgene_196951 Copy   


http://www.addgene.org/206124

Species: Rattus norvegicus
Genetic Insert: cacna1a
Vector Backbone Description: Backbone Marker:Invitrogen Life Technologies; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31577951

Proper citation: RRID:Addgene_206124 Copy   


http://www.addgene.org/206125

Species: Rattus norvegicus
Genetic Insert: cacna1a
Vector Backbone Description: Backbone Marker:Invitrogen Life Technologies; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31577951

Proper citation: RRID:Addgene_206125 Copy   


  • RRID:Addgene_195713

http://www.addgene.org/195713

Species: Rattus norvegicus
Genetic Insert: Syt9
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36732068
Comments: amino terminal GST followed by thrombin cleavage site followeed by SUMO folowed by full length SYT9 Please visit https://www.biorxiv.org/content/10.1101/2022.04.18.488681v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_195713 Copy   


  • RRID:Addgene_195712

http://www.addgene.org/195712

Species: Rattus norvegicus
Genetic Insert: Syt1
Vector Backbone Description: Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36732068
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.04.18.488681v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_195712 Copy   


  • RRID:Addgene_206194

http://www.addgene.org/206194

Species: Rattus norvegicus
Genetic Insert: miRFP704nano-LC-Myosin
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37347539

Proper citation: RRID:Addgene_206194 Copy   


http://www.addgene.org/196568

Species: Rattus norvegicus
Genetic Insert: (I205K)alpha-CaMKII
Vector Backbone Description: Backbone Marker:Clontech, USA; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19453375

Proper citation: RRID:Addgene_196568 Copy   


http://www.addgene.org/196567

Species: Rattus norvegicus
Genetic Insert: GFP-alpha-CaMKII
Vector Backbone Description: Backbone Marker:Clontech, USA; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19453375

Proper citation: RRID:Addgene_196567 Copy   


http://www.addgene.org/196569

Species: Rattus norvegicus
Genetic Insert: (E96A)alpha-CaMKII
Vector Backbone Description: Backbone Marker:Clontech, USA; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19453375

Proper citation: RRID:Addgene_196569 Copy   


http://www.addgene.org/200830

Species: Rattus norvegicus
Genetic Insert: TRPV1-P2A-DsRed
Vector Backbone Description: Backbone Size:4560; Vector Backbone:pAAV-hSyn-hM4D(Gi)-mCherry; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33989819

Proper citation: RRID:Addgene_200830 Copy   


http://www.addgene.org/200831

Species: Rattus norvegicus
Genetic Insert: TRPV1-P2A-mCherry
Vector Backbone Description: Backbone Size:4800; Vector Backbone:AAV-hSyn-DIO-hM4D(Gi)-mCherry; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33989819

Proper citation: RRID:Addgene_200831 Copy   


http://www.addgene.org/198851

Species: Rattus norvegicus
Genetic Insert: ND1-W86-R17 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG

Proper citation: RRID:Addgene_198851 Copy   


  • RRID:Addgene_202799

http://www.addgene.org/202799

Species: Rattus norvegicus
Genetic Insert: Lamp1
Vector Backbone Description: Vector Backbone:Original RUSH construct (gift of F. Perezand G. Boncompain, Curie Institute; Boncompain et al., 2012, Nature Methods); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28978644

Proper citation: RRID:Addgene_202799 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X