Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: protein tyrosine kinase
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10427092
Comments: Fluorophore encoded by this plasmid is ABB59962.1 with G66A.
Proper citation: RRID:Addgene_50515 Copy
Genetic Insert: hM4D(Gi)-mCherry
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.
Proper citation: RRID:Addgene_50479 Copy
Species: Homo sapiens
Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9616126
Proper citation: RRID:Addgene_50519 Copy
Species: Gallus gallus
Genetic Insert: Vinculin
Vector Backbone Description: Backbone Marker:Yamada Lab; Vector Backbone:pmCherry NBC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Replacement of Clontech pEGFP C1 vector EGFP with mCherry and MCS modification with Bam HI mutation of original Bam H I.
Proper citation: RRID:Addgene_50527 Copy
Species: Homo sapiens
Genetic Insert: PXN paxillin
Vector Backbone Description: Backbone Marker:Yamada Lab; Vector Backbone:pmCherry NBC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Replacement of Clontech pEGFP C1 vector EGFP with mCherry and MCS modification with Bam HI mutation of original Bam H I.
Proper citation: RRID:Addgene_50526 Copy
Species: Homo sapiens
Genetic Insert: TRF2
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4378; Vector Backbone:pTrcHisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25115914
Comments: This set of TRF2 and TRF2 mutant vectors has been engineered reintroduce Alanine 434, which is deleted in most published TRF2 vectors, and to generate TRF2 and TRF2 mutant proteins with identical N-terminal tags.
Proper citation: RRID:Addgene_50488 Copy
Species: Homo sapiens
Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9616126
Proper citation: RRID:Addgene_50520 Copy
Species: Homo sapiens
Genetic Insert: Paxillin
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_50529 Copy
Species: Homo sapiens
Genetic Insert: fibronectin
Vector Backbone Description: Vector Backbone:pVC70108; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7929152
Comments: Primers used for amplification of insert: primer A (CCATATGGGTCGACCCAACTGG), which contains an NdeI site, methionine start codon, and 5' end of the 9th type III repeat sequence, and primer B (ATGAATTCTACATCTGGGATGGTTTGTCAA), which contains an EcoRI site, a stop codon, and the 3' end of the 37-kDa fibronectin fragment.
Proper citation: RRID:Addgene_50495 Copy
Species: Other
Genetic Insert: MitoTimer
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:2516; Vector Backbone:pTRE Tight; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24128932
Comments: The F12S mutation in Timer does not affect the function of the plasmid, as described in the associated publication.
The Timer sequence is preceded by the mitochondrial targeting sequence from cytochrome c oxidase subunit 8A: MSVLTPLLLRGLTGSARRLPVPRAKIHSL
Proper citation: RRID:Addgene_50547 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Registry of Standard Biological Parts; Backbone Size:3296; Vector Backbone:pSB4A3; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24608181
Comments: Note: Addgene's quality control sequencing found a few mismatches compared to the depositor's full sequence, but they should not affect plasmid function.
Proper citation: RRID:Addgene_50549 Copy
Species: Synechocystis sp. 6803
Genetic Insert: CcaS
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:1900; Vector Backbone:pProTet.E333; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24608181
Proper citation: RRID:Addgene_50551 Copy
Species: Drosophila melanogaster
Genetic Insert: Argonaute2
Vector Backbone Description: Backbone Marker:The Drosophila Gateway™ Vector Collection; Vector Backbone:pAFW; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20605501
Comments: Please note that when compared to GenBank reference sequence NP_648775.1, the Ago2 sequence in this plasmid is missing amino acids 49-54 (LQQPQQ).
Proper citation: RRID:Addgene_50554 Copy
Genetic Insert: tyrB
Vector Backbone Description: Vector Backbone:pRBS-01; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22020510
Proper citation: RRID:Addgene_50606 Copy
Species: Mus musculus
Genetic Insert: UBR2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5427; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_50573 Copy
Species: Synthetic
Genetic Insert: zCas9D10A
Vector Backbone Description: Backbone Marker:Mullineaux Lab, see http://www.pgreen.ac.uk/; Vector Backbone:pGreen-like binary vector; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin and Spectinomycin
Defining Citation: PMID:25432517
Proper citation: RRID:Addgene_50582 Copy
Species: Synthetic
Genetic Insert: dCas9-KRAB
Vector Backbone Description: Backbone Marker:Mullineaux Lab, see http://www.pgreen.ac.uk/; Vector Backbone:pGreen-like binary vector; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin and Spectinomycin
Defining Citation: PMID:25432517
Proper citation: RRID:Addgene_50580 Copy
Species: Synthetic
Genetic Insert: dCas9-KRAB
Vector Backbone Description: Backbone Marker:Mullineaux Lab, see http://www.pgreen.ac.uk/; Vector Backbone:pGreen-like binary vector; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin and Spectinomycin
Defining Citation: PMID:25432517
Proper citation: RRID:Addgene_50587 Copy
Vector Backbone Description: Vector Backbone:pCVL TAL(Nd154C63) SFFV Xba-Sal linkers; Vector Types:Mammalian Expression, Lentiviral, TALEN; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_50627 Copy
Species: Synthetic
Genetic Insert: T1, gRNA scaffold, OsU3t plus, TaU3p, T2
Vector Backbone Description: Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25432517
Comments: Please note that this plasmid runs as a dimer (>7kb) or multimer.
Proper citation: RRID:Addgene_50593 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.