Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pGFP FAK Resource Report Resource Website 10+ mentions |
RRID:Addgene_50515 | protein tyrosine kinase | Mus musculus | Ampicillin | PMID:10427092 | Fluorophore encoded by this plasmid is ABB59962.1 with G66A. | Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:08 | 13 | |
|
pAAV-GFAP-hM4D(Gi)-mCherry Resource Report Resource Website 10+ mentions |
RRID:Addgene_50479 | hM4D(Gi)-mCherry | Ampicillin | These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. | Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | See supplemental documents for DREADD mutations | 2026-08-15 01:16:06 | 18 | ||
|
pGFP-PTEN Resource Report Resource Website 1+ mentions |
RRID:Addgene_50519 | PTEN | Homo sapiens | Ampicillin | PMID:9616126 | Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:06 | 1 | ||
|
pmCherry Vinculin Resource Report Resource Website 1+ mentions |
RRID:Addgene_50527 | Vinculin | Gallus gallus | Kanamycin | Replacement of Clontech pEGFP C1 vector EGFP with mCherry and MCS modification with Bam HI mutation of original Bam H I. | Backbone Marker:Yamada Lab; Vector Backbone:pmCherry NBC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:08 | 2 | ||
|
pmCherry Paxillin Resource Report Resource Website 10+ mentions |
RRID:Addgene_50526 | PXN paxillin | Homo sapiens | Kanamycin | Replacement of Clontech pEGFP C1 vector EGFP with mCherry and MCS modification with Bam HI mutation of original Bam H I. | Backbone Marker:Yamada Lab; Vector Backbone:pmCherry NBC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:06 | 23 | ||
|
pTrcHisB-TRF2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50488 | TRF2 | Homo sapiens | Ampicillin | PMID:25115914 | This set of TRF2 and TRF2 mutant vectors has been engineered reintroduce Alanine 434, which is deleted in most published TRF2 vectors, and to generate TRF2 and TRF2 mutant proteins with identical N-terminal tags. | Backbone Marker:Life Technologies; Backbone Size:4378; Vector Backbone:pTrcHisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Contains amino acids 3-500 | 2026-08-15 01:16:06 | 2 |
|
pGFP-PTEN C124A Resource Report Resource Website 1+ mentions |
RRID:Addgene_50520 | PTEN | Homo sapiens | Ampicillin | PMID:9616126 | Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C124A | 2026-08-15 01:16:06 | 1 | |
|
pRK GFP Paxillin Resource Report Resource Website 10+ mentions |
RRID:Addgene_50529 | Paxillin | Homo sapiens | Ampicillin | Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:06 | 10 | |||
|
FN 108 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50495 | fibronectin | Homo sapiens | Ampicillin | PMID:7929152 | Primers used for amplification of insert: primer A (CCATATGGGTCGACCCAACTGG), which contains an NdeI site, methionine start codon, and 5' end of the 9th type III repeat sequence, and primer B (ATGAATTCTACATCTGGGATGGTTTGTCAA), which contains an EcoRI site, a stop codon, and the 3' end of the 37-kDa fibronectin fragment. | Vector Backbone:pVC70108; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | repeats 9 and 10; EcoR1 site on III-9 is mutated, nt change T4153C | 2026-08-15 01:16:06 | 1 |
|
pTRE-Tight-MitoTimer Resource Report Resource Website 10+ mentions |
RRID:Addgene_50547 | MitoTimer | Other | Ampicillin | PMID:24128932 | The F12S mutation in Timer does not affect the function of the plasmid, as described in the associated publication. The Timer sequence is preceded by the mitochondrial targeting sequence from cytochrome c oxidase subunit 8A: MSVLTPLLLRGLTGSARRLPVPRAKIHSL | Backbone Marker:Clonetech; Backbone Size:2516; Vector Backbone:pTRE Tight; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | F12S mutation in Timer | 2026-08-15 01:16:06 | 15 |
|
pBL6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50549 | mCherry | Synthetic | Ampicillin | PMID:24608181 | Note: Addgene's quality control sequencing found a few mismatches compared to the depositor's full sequence, but they should not affect plasmid function. | Backbone Marker:Registry of Standard Biological Parts; Backbone Size:3296; Vector Backbone:pSB4A3; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:06 | 1 | |
|
pJT119b Resource Report Resource Website 1+ mentions |
RRID:Addgene_50551 | CcaS | Synechocystis sp. 6803 | Chloramphenicol | PMID:24608181 | Backbone Marker:Clontech; Backbone Size:1900; Vector Backbone:pProTet.E333; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:16:09 | 4 | ||
|
pAFW-Ago2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50554 | Argonaute2 | Drosophila melanogaster | Ampicillin | PMID:20605501 | Please note that when compared to GenBank reference sequence NP_648775.1, the Ago2 sequence in this plasmid is missing amino acids 49-54 (LQQPQQ). | Backbone Marker:The Drosophila Gateway™ Vector Collection; Vector Backbone:pAFW; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:09 | 3 | |
|
pY3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50606 | tyrB | Ampicillin | PMID:22020510 | Vector Backbone:pRBS-01; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:07 | 3 | |||
|
pcDNA3.1(-)-flag-UBR2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50573 | UBR2 | Mus musculus | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5427; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:07 | 1 | |||
|
pBUN501 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50582 | zCas9D10A | Synthetic | Kanamycin and Spectinomycin | PMID:25432517 | Backbone Marker:Mullineaux Lab, see http://www.pgreen.ac.uk/; Vector Backbone:pGreen-like binary vector; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin and Spectinomycin | Cas9D10A nickase, was derived from the zCas9 and included in the toolkit to facilitate HR-based gene replacement or NHEJ-based insertion/deletion events (indels) through offset nicking under the precondition of the avoidance of off-target effects | 2026-08-15 01:16:09 | 1 | |
|
pBUN6I11 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50580 | dCas9-KRAB | Synthetic | Kanamycin and Spectinomycin | PMID:25432517 | Backbone Marker:Mullineaux Lab, see http://www.pgreen.ac.uk/; Vector Backbone:pGreen-like binary vector; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin and Spectinomycin | dCas9 that is defective in DNA cleavage; the maize codon–optimized dCas9-KRAB (Krüppel-associated box) vector was constructed for targeted knockdown of genes of interest. | 2026-08-15 01:16:07 | 1 | |
|
pHSN6I01 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50587 | dCas9-KRAB | Synthetic | Kanamycin and Spectinomycin | PMID:25432517 | Backbone Marker:Mullineaux Lab, see http://www.pgreen.ac.uk/; Vector Backbone:pGreen-like binary vector; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin and Spectinomycin | dCas9 that is defective in DNA cleavage; the maize codon–optimized dCas9-KRAB (Krüppel-associated box) vector was constructed for targeted knockdown of genes of interest. | 2026-08-15 01:16:07 | 2 | |
|
pCVL RipTAL(Nd154C63) SFFV Xba-Sal linker Resource Report Resource Website 1+ mentions |
RRID:Addgene_50627 | Ampicillin | Vector Backbone:pCVL TAL(Nd154C63) SFFV Xba-Sal linkers; Vector Types:Mammalian Expression, Lentiviral, TALEN; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:09 | 1 | |||||
|
pCBC-MT1T2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50593 | T1, gRNA scaffold, OsU3t plus, TaU3p, T2 | Synthetic | Chloramphenicol | PMID:25432517 | Please note that this plasmid runs as a dimer (>7kb) or multimer. | Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:16:07 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
