Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: NavB4-GFP
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19228957
Comments: A V228L mutation was found in NavB4.
This is a validated antigen plasmid of Anti-Navbeta4 Na+ channel [N168/6.3R].
Proper citation: RRID:Addgene_197310 Copy
Species: Rattus norvegicus
Genetic Insert: Neurexin 1beta
Vector Backbone Description: Backbone Marker:#58267 (alt); Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-Neurexin-1-Beta [N170A/1.1R].
Proper citation: RRID:Addgene_197339 Copy
Species: Rattus norvegicus
Genetic Insert: cacna2d1
Vector Backbone Description: Backbone Marker:Genetics Institute Inc; Backbone Size:5163; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33986433
Proper citation: RRID:Addgene_206062 Copy
Species: Rattus norvegicus
Genetic Insert: Nedd1-mOrange2-rCM1
Vector Backbone Description: Backbone Size:7664; Vector Backbone:pCAG-lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36796357
Proper citation: RRID:Addgene_196879 Copy
Species: Rattus norvegicus
Genetic Insert: GFP-alpha-CaMKII and MLS-NR2B
Vector Backbone Description: Backbone Marker:Clontech, USA; Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29966860
Proper citation: RRID:Addgene_196565 Copy
Species: Rattus norvegicus
Genetic Insert: Kv1.5
Vector Backbone Description: Vector Backbone:RBG4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-Kv1.5 K+ channel [K7/45R]
Proper citation: RRID:Addgene_196945 Copy
Species: Rattus norvegicus
Genetic Insert: Kv1.2
Vector Backbone Description: Vector Backbone:RBG4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-Kv1.2 K+ channel [K14/16R]
Proper citation: RRID:Addgene_196941 Copy
Species: Rattus norvegicus
Genetic Insert: mmp-9
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-MMP9 precursor [L51/82R]
Proper citation: RRID:Addgene_196951 Copy
Species: Rattus norvegicus
Genetic Insert: cacna1a
Vector Backbone Description: Backbone Marker:Invitrogen Life Technologies; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31577951
Proper citation: RRID:Addgene_206124 Copy
Species: Rattus norvegicus
Genetic Insert: cacna1a
Vector Backbone Description: Backbone Marker:Invitrogen Life Technologies; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31577951
Proper citation: RRID:Addgene_206125 Copy
Species: Rattus norvegicus
Genetic Insert: Syt9
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36732068
Comments: amino terminal GST followed by thrombin cleavage site followeed by SUMO folowed by full length SYT9
Please visit https://www.biorxiv.org/content/10.1101/2022.04.18.488681v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_195713 Copy
Species: Rattus norvegicus
Genetic Insert: Syt1
Vector Backbone Description: Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36732068
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.04.18.488681v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_195712 Copy
Species: Rattus norvegicus
Genetic Insert: miRFP704nano-LC-Myosin
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37347539
Proper citation: RRID:Addgene_206194 Copy
Species: Rattus norvegicus
Genetic Insert: (I205K)alpha-CaMKII
Vector Backbone Description: Backbone Marker:Clontech, USA; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19453375
Proper citation: RRID:Addgene_196568 Copy
Species: Rattus norvegicus
Genetic Insert: GFP-alpha-CaMKII
Vector Backbone Description: Backbone Marker:Clontech, USA; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19453375
Proper citation: RRID:Addgene_196567 Copy
Species: Rattus norvegicus
Genetic Insert: (E96A)alpha-CaMKII
Vector Backbone Description: Backbone Marker:Clontech, USA; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19453375
Proper citation: RRID:Addgene_196569 Copy
Species: Rattus norvegicus
Genetic Insert: TRPV1-P2A-DsRed
Vector Backbone Description: Backbone Size:4560; Vector Backbone:pAAV-hSyn-hM4D(Gi)-mCherry; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33989819
Proper citation: RRID:Addgene_200830 Copy
Species: Rattus norvegicus
Genetic Insert: TRPV1-P2A-mCherry
Vector Backbone Description: Backbone Size:4800; Vector Backbone:AAV-hSyn-DIO-hM4D(Gi)-mCherry; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33989819
Proper citation: RRID:Addgene_200831 Copy
Species: Rattus norvegicus
Genetic Insert: ND1-W86-R17 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198851 Copy
Species: Rattus norvegicus
Genetic Insert: Lamp1
Vector Backbone Description: Vector Backbone:Original RUSH construct (gift of F. Perezand G. Boncompain, Curie Institute; Boncompain et al., 2012, Nature Methods); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28978644
Proper citation: RRID:Addgene_202799 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.