Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:rattus norvegicus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

2,177 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
NavB4-GFP/pEGFP-N1
 
Resource Report
Resource Website 		RRID:Addgene_197310 NavB4-GFP Rattus norvegicus Kanamycin PMID:19228957 A V228L mutation was found in NavB4. This is a validated antigen plasmid of Anti-Navbeta4 Na+ channel [N168/6.3R]. Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:27:14 0
Nxn-1 beta Flag/pCMV
 
Resource Report
Resource Website 		RRID:Addgene_197339 Neurexin 1beta Rattus norvegicus Ampicillin This is a validated antigen plasmid of Anti-Neurexin-1-Beta [N170A/1.1R]. Backbone Marker:#58267 (alt); Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:15 0
cacna2d1 BBS pMT2
 
Resource Report
Resource Website 		RRID:Addgene_206062 cacna2d1 Rattus norvegicus Ampicillin PMID:33986433 Backbone Marker:Genetics Institute Inc; Backbone Size:5163; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:44 0
pCAG-lox-inv[Talpha1-iCre-pA]-lox-Nedd1-mOrange2-rCM1
 
Resource Report
Resource Website 		RRID:Addgene_196879 Nedd1-mOrange2-rCM1 Rattus norvegicus Ampicillin PMID:36796357 Backbone Size:7664; Vector Backbone:pCAG-lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:27:48 0
pIRES-M2BIGC
 
Resource Report
Resource Website 		RRID:Addgene_196565 GFP-alpha-CaMKII and MLS-NR2B Rattus norvegicus Ampicillin PMID:29966860 Backbone Marker:Clontech, USA; Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Nil 2026-08-15 01:27:49 0
Kv1.5/RBG4
 
Resource Report
Resource Website 		RRID:Addgene_196945 Kv1.5 Rattus norvegicus Ampicillin This is a validated antigen plasmid of Anti-Kv1.5 K+ channel [K7/45R] Vector Backbone:RBG4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:48 0
Kv1.2/RBG4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_196941 Kv1.2 Rattus norvegicus Ampicillin This is a validated antigen plasmid of Anti-Kv1.2 K+ channel [K14/16R] Vector Backbone:RBG4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:48 1
Rat MMP-9 pcDNA3.1
 
Resource Report
Resource Website 		RRID:Addgene_196951 mmp-9 Rattus norvegicus Ampicillin This is a validated antigen plasmid of Anti-MMP9 precursor [L51/82R] Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:48 0
Cav2.1 HA EIA (E320A) pcDNA3
 
Resource Report
Resource Website 		RRID:Addgene_206124 cacna1a Rattus norvegicus Ampicillin PMID:31577951 Backbone Marker:Invitrogen Life Technologies; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin E320A 2026-08-15 01:27:54 0
Cav2.1 EIVA (E1707A) pcDNA3
 
Resource Report
Resource Website 		RRID:Addgene_206125 cacna1a Rattus norvegicus Ampicillin PMID:31577951 Backbone Marker:Invitrogen Life Technologies; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin E1707A 2026-08-15 01:27:54 0
pET (SUMO)-Syt9
 
Resource Report
Resource Website 		RRID:Addgene_195713 Syt9 Rattus norvegicus Kanamycin PMID:36732068 amino terminal GST followed by thrombin cleavage site followeed by SUMO folowed by full length SYT9 Please visit https://www.biorxiv.org/content/10.1101/2022.04.18.488681v2 for bioRxiv preprint. Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:27:55 0
pGEX SYT1 C2AB
 
Resource Report
Resource Website 		RRID:Addgene_195712 Syt1 Rattus norvegicus Ampicillin PMID:36732068 Please visit https://www.biorxiv.org/content/10.1101/2022.04.18.488681v2 for bioRxiv preprint. Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin encodes amino acids 96-421 of mouse SYT1 2026-08-15 01:27:55 0
pMyosin-miRFP704nano
 
Resource Report
Resource Website 		RRID:Addgene_206194 miRFP704nano-LC-Myosin Rattus norvegicus Ampicillin PMID:37347539 Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:56 0
pEGFP-C1-(I205K)alpha-CaMKII
 
Resource Report
Resource Website 		RRID:Addgene_196568 (I205K)alpha-CaMKII Rattus norvegicus Kanamycin PMID:19453375 Backbone Marker:Clontech, USA; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin I205K 2026-08-15 01:28:01 0
pEGFP-C1-alpha-CaMKII
 
Resource Report
Resource Website 		RRID:Addgene_196567 GFP-alpha-CaMKII Rattus norvegicus Kanamycin PMID:19453375 Backbone Marker:Clontech, USA; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Nil 2026-08-15 01:28:01 0
pEGFP-C1-(E96A)alpha-CaMKII
 
Resource Report
Resource Website 		RRID:Addgene_196569 (E96A)alpha-CaMKII Rattus norvegicus Kanamycin PMID:19453375 Backbone Marker:Clontech, USA; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin E96A 2026-08-15 01:28:01 0
AAV-Syn-TRPV1-P2A-DsRed
 
Resource Report
Resource Website 		RRID:Addgene_200830 TRPV1-P2A-DsRed Rattus norvegicus Ampicillin PMID:33989819 Backbone Size:4560; Vector Backbone:pAAV-hSyn-hM4D(Gi)-mCherry; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:26:58 0
AAV-Syn-DIO-TRPV1-P2A-mCherry
 
Resource Report
Resource Website 		RRID:Addgene_200831 TRPV1-P2A-mCherry Rattus norvegicus Ampicillin PMID:33989819 Backbone Size:4800; Vector Backbone:AAV-hSyn-DIO-hM4D(Gi)-mCherry; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:26:58 0
pGL3-MTS-ND1-W86-R17-G1333N-UGI-Puro
 
Resource Report
Resource Website 		RRID:Addgene_198851 ND1-W86-R17 TALEN Rattus norvegicus Ampicillin PMID:37058569 These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:31 0
Lamp1-mCherry-RUSH
 
Resource Report
Resource Website 		RRID:Addgene_202799 Lamp1 Rattus norvegicus Ampicillin PMID:28978644 Vector Backbone:Original RUSH construct (gift of F. Perezand G. Boncompain, Curie Institute; Boncompain et al., 2012, Nature Methods); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:33 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch