Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Danio rerio
Genetic Insert: mogat3b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII-TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:39510175
Proper citation: RRID:Addgene_232136 Copy
Species: Danio rerio
Genetic Insert: dgat2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII-TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:39510175
Proper citation: RRID:Addgene_232134 Copy
Species: Danio rerio
Genetic Insert: dgat1a
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII-TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:39510175
Proper citation: RRID:Addgene_232137 Copy
Vector Backbone Description: Vector Backbone:lvl2 [backbone]; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:25378321
Comments: This plasmid is slightly modified from the version used in Duportet et al. 2014, but does not have any functional differences.
Proper citation: RRID:Addgene_229208 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:PCR4-TOPO; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:39762235
Proper citation: RRID:Addgene_211942 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:13909; Vector Backbone:PCR4-TOPO; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:39762235
Proper citation: RRID:Addgene_216394 Copy
Vector Backbone Description: Backbone Marker:Philip Poole lab; Backbone Size:5565; Vector Backbone:pTn7-SCOUT20; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:38715147
Comments: Ec100D pir-116 genotype:
F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir-116(DHRF) Maintains plasmids at ~250 copies per cell.
This strain is naturally resistant to streptomycin
Proper citation: RRID:Addgene_200996 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:PCR4-TOPO; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:39762235
Proper citation: RRID:Addgene_211941 Copy
Genetic Insert: Yellow fluorescent protein
Vector Backbone Description: Backbone Size:6500; Vector Backbone:pMB1; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:33443634
Proper citation: RRID:Addgene_215654 Copy
Species: Homo sapiens
Genetic Insert: WapI
Vector Backbone Description: Backbone Size:3913; Vector Backbone:pCR2.1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:37357575
Proper citation: RRID:Addgene_217666 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:PCR4-TOPO; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:38844479
Proper citation: RRID:Addgene_227000 Copy
Species: Synthetic
Genetic Insert: superfolder GFP
Vector Backbone Description: Backbone Marker:Philip Poole lab; Backbone Size:5262; Vector Backbone:pTn7-SCOUT11; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:38715147
Comments: Ec100D pir+ genotype:
F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir+(DHRF) Maintains plasmids at ~15 copies per cell.
This strain is naturally resistant to streptomycin
Proper citation: RRID:Addgene_201000 Copy
Species: Synthetic
Genetic Insert: sYFP2
Vector Backbone Description: Backbone Marker:Philip Poole lab; Backbone Size:5565; Vector Backbone:pTn7-SCOUT22; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:38715147
Comments: Ec100D pir+ genotype:
F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir+(DHRF) Maintains plasmids at ~15 copies per cell.
This strain is naturally resistant to streptomycin
Proper citation: RRID:Addgene_201019 Copy
Vector Backbone Description: Backbone Marker:Philip Poole lab; Backbone Size:5262; Vector Backbone:pTn7-SCOUT10; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:38715147
Comments: Ec100D pir-116 genotype:
F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir-116(DHRF) Maintains plasmids at ~250 copies per cell.
This strain is naturally resistant to streptomycin
Proper citation: RRID:Addgene_200992 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-127-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103194 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-1271-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103196 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-1185-1-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103180 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-1185-2-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103181 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-10a-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103176 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-10b-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103179 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
