Plasmids   Select Another Resource Report Type

http://www.addgene.org/51545

Genetic Insert: GFP4m
Vector Backbone Description: Vector Backbone:p2attNG; Vector Types:Mammalian Expression, Human Targeting; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24304893

Proper citation: RRID:Addgene_51545 Copy   

•   Source: Addgene

http://www.addgene.org/52628

Species: Bacterial origin
Genetic Insert: Kanamycin cassette
Vector Backbone Description: Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Comments: This is a second generation plasmid that increases the efficiency of sgRNA guide cloning over the original "pLKO.1-puro U6 sgRNA BspMI stuffer" vector. "pLKO.1-puro U6 sgRNA BfuAI large stuffer" was created to simplify the cloning of the sgRNA guide cassette into pLKO.1-puro U6 sgRNA BspMI stuffer vector originally described in the manuscript “Kearns, NA, etal. Development 2014, 141(1):219-23”. The original vector has a small intervening sequence that presents two problems: 1) the efficiency of excision by BfuAI is moderate, and 2) the size of this spacer is similar to the guide sequence, which makes distinguishing positive clones from reclosures challenging. Consequently, we have inserted a Kanamycin cassette between these sites at a unique Bcl1 site. This element is more efficiently excised by BfuAI and makes distinguishing vectors containing the desired guide sequence easy to distinguish from the parent vector. The excision of the Kan cassette by BfuAI cuts this cassette into 3 fragments due to two internal BfuAI sites within the Kan cassette. Otherwise the cloning of the guides is carried out as described in the manuscript.

Proper citation: RRID:Addgene_52628 Copy   

•   Source: Addgene

http://www.addgene.org/46767

Vector Backbone Description: Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23799955
Comments: This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between lacZ homologous arms and integrated at the lacZ locus.

Proper citation: RRID:Addgene_46767 Copy   

•   Source: Addgene

http://www.addgene.org/46766

Vector Backbone Description: Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23799955
Comments: This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between arsB homologous arms and integrated at the arsB locus.

Proper citation: RRID:Addgene_46766 Copy   

•   Source: Addgene

http://www.addgene.org/53969

Species: Mus musculus
Genetic Insert: mouse Ins2 gene partial
Vector Backbone Description: Backbone Marker:Life Technologies; Vector Backbone:pCR2.1-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23144715

Proper citation: RRID:Addgene_53969 Copy   

•   Source: Addgene

http://www.addgene.org/53970

Species: Homo sapiens
Genetic Insert: human INS gene partial
Vector Backbone Description: Backbone Marker:Life Technologies; Vector Backbone:pCR2.1-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23144715

Proper citation: RRID:Addgene_53970 Copy   

•   Source: Addgene

http://www.addgene.org/64711

Species: Synthetic
Genetic Insert: Streptococcus pyogenes guide RNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3979; Vector Backbone:pCRII-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23561441

Proper citation: RRID:Addgene_64711 Copy   

•   Source: Addgene

http://www.addgene.org/64969

Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18R6KT-mini-Tn7T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:15908923
Comments: The uncut plasmid runs as a multimer (>10kb). Multimerization often does not impact plasmid function, but may reduce transformation efficiencies. If the monomer is needed, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.

Proper citation: RRID:Addgene_64969 Copy   

•   Source: Addgene

http://www.addgene.org/64944

Species: Synthetic
Genetic Insert: SEP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24403083
Comments: Note that the coding sequence for SEP is lacking a start codon.

Proper citation: RRID:Addgene_64944 Copy   

•   Source: Addgene

http://www.addgene.org/64950

Genetic Insert: FRT-KmR-FRT
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pFRT2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:15908923
Comments: GenBank Accession #AY597272 Compared to the Genbank reference sequence AY597272, Addgene's sequencing results found N18I, R145C and D146N mutations in the kanamycin cassette. The effect of these differences is unknown.

Proper citation: RRID:Addgene_64950 Copy   

•   Source: Addgene

http://www.addgene.org/58305

Species: Synthetic
Genetic Insert: Genomic cassette
Vector Backbone Description: Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24847673

Proper citation: RRID:Addgene_58305 Copy   

•   Source: Addgene

http://www.addgene.org/58304

Species: Synthetic
Genetic Insert: Genomic cassette
Vector Backbone Description: Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24847673

Proper citation: RRID:Addgene_58304 Copy   

•   Source: Addgene

http://www.addgene.org/58307

Species: Synthetic
Genetic Insert: Genomic cassette
Vector Backbone Description: Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24847673

Proper citation: RRID:Addgene_58307 Copy   

•   Source: Addgene

http://www.addgene.org/59383

Species: Synthetic
Genetic Insert: TT-ISceI-kan
Vector Backbone Description: Backbone Marker:Copley Lab; Backbone Size:1887; Vector Backbone:pHA1887, an 1887 bp fragment extending from bp 690 to bp 2576 of pUC19 (Acc. No. M77789); Vector Types:template; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:25255806
Comments: iGEM parts BBa_B1002 and BBa_B1006 were used to build the double terminator element. The kanamycin resistance gene was taken from pACYC177. We developed GetX (https://sourceforge.net/projects/getx/), a stand-alone python script that allows the user to design mutation cassettes for scarless genome editing in bacteria using our previously described two-step recombination method. Please see the document linked under the Resource Information heading above for additional information on installing and using the script.

Proper citation: RRID:Addgene_59383 Copy   

•   Source: Addgene

http://www.addgene.org/60487

Vector Backbone Description: Backbone Size:4384; Vector Backbone:pBAM1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:21342504

Proper citation: RRID:Addgene_60487 Copy   

•   Source: Addgene

http://www.addgene.org/60961

Genetic Insert: eGFP-Kana_I-SceI
Vector Backbone Description: Vector Backbone:pEGFP N1; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:16526409

Proper citation: RRID:Addgene_60961 Copy   

•   Source: Addgene

http://www.addgene.org/61069

Species: Synthetic
Genetic Insert: eGFPbait
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCRII-TOPO; Vector Types:zebrafish expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24179142
Comments: The eGFPbait-E2A-KalTA4 donor plasmid was generated by forward insertion of a PCR-amplified eGFP fragment into the pCRII-TOPO vector. Primers used were eGFP_fwd: ATAGTGGTACCATGGTGAGCAAGGGCGAGGAGC, and eGFP_rev: GTAGCGGCTGAAGCACTGCACGC. The E2A-KalTA4-pA fragment was generated by fusion of individual PCR products using Phusion High-Fidelity DNA Polymerase (Thermo Scientific); E2A was amplified with the primers E2A_fwd: TGCAGATATCCAGGAGGAGGACAGTGTACTAATTATGCTC, E2A_rev: TTCCTCCTCCGGGACCTGGGTTGCTC from a previously generated E2A sequence (Szymczak et al. 2004, PMID 15064769). KalTA4-pA was amplified with KalTA4_fwd: CCCAGGTCCCGGAGGAGGAAAACTGCTC, KalTA4_rev: CATGCTCGAGTCCACTAGTTCTAGAGCG, using the 4 × Kaloop vector as template (Distel et al. 2009, PMID 19628697). Subsequently, both fragments were fused, amplified, and inserted into pCRII-TOPO-eGFPbait with EcoRV and XhoI.

Proper citation: RRID:Addgene_61069 Copy   

•   Source: Addgene

http://www.addgene.org/61518

Species: Homo sapiens
Genetic Insert: NEAT1
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4000; Vector Backbone:PCRII; Vector Types:general cloning vector; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:19217333
Comments: *To create this plasmid, hNEAT1 was amplified from HeLa cDNA. The insert contains two mismatches (C->T at bp 78, and A->G at bp 91, an A->G at bp 1666, and a deletion of TA at bp 2031 and 2032 using the numbering of NR_028272.1) compared to the canonical hNEAT1 sequence. These variants are likely to be encoded in the HeLa genome, as they appeared in multiple clones, but this is yet to be verified by sequencing of HeLa genomic DNA.

Proper citation: RRID:Addgene_61518 Copy   

•   Source: Addgene

http://www.addgene.org/61601

Genetic Insert: Kana_I-SceI
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:16526409

Proper citation: RRID:Addgene_61601 Copy   

•   Source: Addgene

http://www.addgene.org/37177

Species: Burkholderia xenovorans
Genetic Insert: coxM1′::lacZ reporter system with higher-affinity RcoM1 binding site at the "e" position AND RcoM1 with C-term 6xHIS
Vector Backbone Description: Vector Backbone:pUX3242 and pUX2410; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Comments: This is Roberts lab strain UQ5853 (Addgene #37159) containing Roberts lab plasmids pUX3242 (pUX2996 with a coxM1′::lacZ reporter system such that ...vector DNA – BamHI (unique site) – higher-affinity binding site at the “e” position (“e↑” binding site = 5′-TCCTACAGTTCACGCACGT-3′) – coxM1′(with unique SalI site)::lacZ-> tfd <-KanR (with 5′-end unique XhoI site) – vector DNA <-SpR...) AND pUX2410 (for expression of Burkholderia xenovorans RcoM1 protein + C-terminal 6×His tag). The strain is CmR, pUX3242 is KanR and SpecR and pUX2410 is AmpR. Can be grown in Amp + Kan. For strain usage see attached pdf.

Proper citation: RRID:Addgene_37177 Copy   

•   Source: Addgene