Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Escherichia coli
Genetic Insert: Deficient in the P2 bacteriophage packaging cos site; rhamnose-inducible P4 delta (δ) and epsilon (ε) genes
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33317264
Comments: P2 bacteriophage lysogen derived from E. coli EMG C-5545 strain.
We designed a pair of primers to check the presence of P2 lysogen in this strain:
- P2 gpH C-ter gpG Fw: 5’ GCAGAGCACGAACAGTCACG 3’
- P2 gpH C-ter gpG Rv: 5’ TTATTGCGGCATTTCCGGCC 3’
These primers amplify the C-terminal region of the P2 gpH gene (tail fiber) and the complete gpG gene (tail fiber chaperone) (PCR fragment size: 2070 bp).
Proper citation: RRID:Addgene_209018 Copy
Vector Backbone Description: Backbone Size:9915; Vector Backbone:pBAC2015, pGM1190, and pUC19; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39666857
Proper citation: RRID:Addgene_227580 Copy
Species: Panicum virgatum
Genetic Insert: Pv4CL1
Vector Backbone Description: Backbone Size:4111; Vector Backbone:MoClo adapted pGAPZ-vector with hygromycin resistance; Vector Types:Yeast Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:38457503
Proper citation: RRID:Addgene_219768 Copy
Species: Derived from Aequorea victoria.
Genetic Insert: sfGFP
Vector Backbone Description: Vector Backbone:p15A and pWH1266; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39302127
Comments: Shuttle vector that replicates in A. baumannii and E. coli; replicates in common cloning strains such as DH10B.
Proper citation: RRID:Addgene_222353 Copy
Vector Backbone Description: Vector Backbone:R6Kγ; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39302127
Comments: Tn7 expression vector.
Proper citation: RRID:Addgene_222357 Copy
Species: Plasmodiophora brassicae
Genetic Insert: PbGH3
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:10141; Vector Backbone:pMDC32; Vector Types:Plant Expression; Bacterial Resistance:Hygromycin
Proper citation: RRID:Addgene_232335 Copy
Species: Mycobacterium tuberculosis
Genetic Insert: PPE18-ALFA
Vector Backbone Description: Backbone Marker:Bryson Lab; Backbone Size:6512; Vector Backbone:pBB115; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Proper citation: RRID:Addgene_231247 Copy
Species: Mycobacterium tuberculosis
Genetic Insert: PPE18-HA
Vector Backbone Description: Backbone Size:6512; Vector Backbone:pBB115; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Proper citation: RRID:Addgene_231246 Copy
Species: n/a
Genetic Insert: MG1655.ΔTAG.ΔTGA.ΔprfA.mprfB3.A37G-tRNA-Trp
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39910296
Proper citation: RRID:Addgene_234622 Copy
Vector Backbone Description: Backbone Marker:Ghader Bashiri; Backbone Size:5087; Vector Backbone:pYUB1049; Vector Types:Bacterial Expression, mycobacteria shuttle vector; Bacterial Resistance:Hygromycin
Defining Citation: PMID:21209917
Proper citation: RRID:Addgene_37278 Copy
Species: M. marinum
Genetic Insert: Mycobacterium Strong Promoter (MSP)
Vector Backbone Description: Backbone Marker:Ramakrishnan et al., 2000; Backbone Size:4981; Vector Backbone:pFPV27; Vector Types:Mycobacteria expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:22840407
Comments: This plasmid was derived from pMSP12::GFP by interrupting the aph gene (removing a small ~300bp NsiI fragment) and inserting the gene for Hygromycin resistance. The GFP was then replaced with tdKatuschka2. The Katuschka tandem-dimer ORF is present at bp# 44-1522
Proper citation: RRID:Addgene_30181 Copy
Species: M. marinum
Genetic Insert: Mycobacterium Strong Promoter (MSP)
Vector Backbone Description: Backbone Marker:Ramakrishnan et al., 2000; Backbone Size:4981; Vector Backbone:pFPV27; Vector Types:Mycobacteria expression; Bacterial Resistance:Hygromycin
Comments: This plasmid was derived from pMSP12::GFP by interrupting the aph gene (removing a small ~300bp NsiI fragment) and inserting the gene for Hygromycin resistance. The GFP was then replaced with Kaede. The Kaede ORF is present at bp# 5624-6304.
Proper citation: RRID:Addgene_30180 Copy
Species: M. marinum
Genetic Insert: Mycobacterium Strong Promoter (MSP)
Vector Backbone Description: Backbone Marker:Ramakrishnan et al., 2000; Backbone Size:4981; Vector Backbone:pFPV27; Vector Types:Mycobacteria expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:23680983
Comments: This plasmid was derived from pMSP12::GFP by interrupting the aph gene (removing a small ~300bp NsiI fragment) and inserting the gene for Hygromycin resistance. The GFP was then replaced with tdTomato. The tdTomato ORF is present at bp# 102-1532.
Proper citation: RRID:Addgene_30182 Copy
Species: M. marinum
Genetic Insert: Mycobacterium Strong Promoter (MSP)
Vector Backbone Description: Backbone Marker:Ramakrishnan et al., 2000; Backbone Size:4981; Vector Backbone:pFPV27; Vector Types:Mycobacteria expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:16714540
Comments: This plasmid was derived from pMSP12::GFP by interrupting the aph gene (removing a small ~300bp NsiI fragment) and inserting the gene for Hygromycin resistance.
Proper citation: RRID:Addgene_30173 Copy
Species: M. marinum
Genetic Insert: Mycobacterium Strong Promoter (MSP)
Vector Backbone Description: Backbone Marker:Ramakrishnan et al., 2000; Backbone Size:4981; Vector Backbone:pFPV27; Vector Types:Mycobacteria expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:23680983
Comments: This plasmid was derived from pMSP12::GFP by interrupting the aph gene (removing a small ~300bp NsiI fragment) and inserting the gene for Hygromycin resistance. The GFP was then replaced with mOrange2. The mOrange2 ORF is present at bp# 5620-6330.
Proper citation: RRID:Addgene_30175 Copy
Species: M. marinum
Genetic Insert: Mycobacterium Strong Promoter (MSP)
Vector Backbone Description: Backbone Marker:Ramakrishnan et al., 2000; Backbone Size:4981; Vector Backbone:pFPV27; Vector Types:Mycobacteria expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:23680983
Comments: This plasmid was derived from pMSP12::GFP by interrupting the aph gene (removing a small ~300bp NsiI fragment) and inserting the gene for Hygromycin resistance. The GFP was then replaced with mKate2. The mKate2 ORF is present at bp# 105-803.
Proper citation: RRID:Addgene_30179 Copy
Genetic Insert: I-SceI
Vector Backbone Description: Vector Backbone:pmsg383; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:21219454
Proper citation: RRID:Addgene_48789 Copy
Species: Synthetic gene
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:5582; Vector Backbone:pSMT3-rpsA; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:20352111
Proper citation: RRID:Addgene_24663 Copy
Species: Synthetic gene
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:5582; Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:20352111
Proper citation: RRID:Addgene_24664 Copy
Genetic Insert: pKW08-Lx-Int
Vector Backbone Description: Backbone Size:8535; Vector Backbone:pMC1M; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:20434484
Proper citation: RRID:Addgene_25015 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
