Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: I-SceI
Vector Backbone Description: Backbone Size:6300; Vector Backbone:pKD46; Vector Types:Bacterial Expression, Red recombinase and I-SceI endonuclease; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747889
Proper citation: RRID:Addgene_51625 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Gal80
Vector Backbone Description: Vector Backbone:Gateway middle entry clone (pME); Vector Types:vertebrate expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21905164
Comments: pME-Gal80 was cloned by PCR from TubP-GAL80 (Lee and Luo, 1999; obtained from Addgene, plasmid #17748) using primers 5'-ATGGACTACAACAAGAGATCTTCG-3' and 5'-TTATAAACTATAATGCGAGATATTGCT-3'.
Proper citation: RRID:Addgene_51620 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: I-SceI
Vector Backbone Description: Backbone Size:6300; Vector Backbone:pKD46; Vector Types:Bacterial Expression, Red recombinase and I-SceI endonuclease; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24747889
Proper citation: RRID:Addgene_51628 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ADE2
Vector Backbone Description: Vector Backbone:pJJ215; Vector Types:Yeast Expression, yeast marker swap; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12898713
Comments: Plasmid was made by cutting pJJ215 with MscI and Nsi I and replacing the 570 bp MscI–Nsi I fragment with a 3.6 kb NotI (blunted with Klenow)–PstI fragment containing ADE2 from plasmid M1144. Plasmid M1144 contains a 3.6 kb BglII fragment (partial digest product) with ADE2 with BamHI linkers cloned into the BamHI site of Bluescript KS+.
Proper citation: RRID:Addgene_51671 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ADE2
Vector Backbone Description: Vector Backbone:pJJ244; Vector Types:Yeast Expression, yeast marker swap; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12898713
Comments: Plasmid M3499 (ura3::ADE2 ) was made by cutting pJJ244 with StuI and EcoRV and replacing the 248 bp StuI–EcoRV fragment with a 3.6 kb BamHI blunted with Klenow) fragment containing ADE2 from plasmid M1144.
Proper citation: RRID:Addgene_51674 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: LYS2
Vector Backbone Description: Vector Backbone:YDp-H; Vector Types:Yeast Expression, yeast marker swap; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12898713
Comments: Plasmid was made by cutting YDp-H with BglII and replacing the 60 bp BglII fragment with a 5 kb BamHI fragment (partial digest product) containing LYS2 from plasmid YDp-K.
Proper citation: RRID:Addgene_51676 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: LYS2
Vector Backbone Description: Backbone Marker:Marsh et al., 1984; Vector Backbone:M581; Vector Types:Yeast Expression, yeast marker swap; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12898713
Comments: Plasmid M2660 (ura3::LYS2 ) was made by cutting M581 with EcoRV and PstI and replacing the 208 bp EcoRV–PstI fragment with a 4.6 kb PvuII–PstI fragment containing LYS2 from plasmid YDp-K.
Proper citation: RRID:Addgene_51678 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: LEU2
Vector Backbone Description: Vector Backbone:M4757 (kanMX::TRP1), Addgene plasmid #51687; Vector Types:Yeast Expression, yeast marker swap; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12898713
Comments: M4756 (kanMX::LEU2)was made by digesting M4757 with BamHI and SphI and inserting a 2.0 kb BamHI–SphI fragment with LEU2 from plasmid pJJ250.
Proper citation: RRID:Addgene_51685 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Set2
Vector Backbone Description: Backbone Marker:commercial; Backbone Size:5400; Vector Backbone:pcDNA3.1 +; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20133523
Proper citation: RRID:Addgene_51698 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Sir2
Vector Backbone Description: Vector Backbone:p413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19390637
Proper citation: RRID:Addgene_51742 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: I-SceI
Vector Backbone Description: Backbone Size:10877; Vector Backbone:pCASPER5; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24748663
Proper citation: RRID:Addgene_52533 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Gal4
Vector Backbone Description: Backbone Marker:David Strutt (Brittle et al., 2010); Vector Backbone:pAct5-FRT-stop-FRT-SV40polyA attB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25605786
Proper citation: RRID:Addgene_52889 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Lifeact
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23870127
Proper citation: RRID:Addgene_46357 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: sgRNA targeting endogenous TRE elements of pTET07 promoter
Vector Backbone Description: Backbone Size:5083; Vector Backbone:AH057; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: gRNA target sequence TATCAGTGATAGAGAAAAGT
Proper citation: RRID:Addgene_46923 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Codon-optimized sequences for MEV pathway expression in E. coli to produce limonene
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pBbA5a; Vector Types:Bacterial Expression, Synthetic Biology, BglBrick; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23727191
Comments: The R364S mutation in the MK is not known to alter the function. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_47049 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MepTrac-H194E
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pDR GW; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23840931
Proper citation: RRID:Addgene_47764 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: meptrac
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pDR GW; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23840931
Proper citation: RRID:Addgene_47768 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL1 promoter
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Comments: GFP in Addgene plasmid #41614 was replaced with stable GFP variant (F64L, S65T, V163A).
Proper citation: RRID:Addgene_53205 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TRP1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17942599
Comments: This plasmid is similar to Addgene plasmid #41597, except the GFP has been switched to a more stable variant.
Proper citation: RRID:Addgene_53184 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HIs3MX6
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17942599
Comments: This plasmid is similar to Addgene plasmid #41598, except the GFP has been switched to a more stable variant.
Proper citation: RRID:Addgene_53185 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
