Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:ampicillin and kanamycin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,971 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Authority Record Last Update Mentions Count
p-ArsRBS2-cre[LVA]-loxPP-syfp2
 
Resource Report
Resource Website
RRID:Addgene_252621 ParsR-arsR-cre[LVA] + PrpsL-loxP-TT-loxP-syfp2 Ampicillin and Kanamycin PMID:40949998 Please visit https://doi.org/10.1101/2024.10.02.616356 for bioRxiv preprint. Backbone Marker:Christopher Voigt (Addgene plasmid #108517); Vector Backbone:p15A-Kan; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:54:24 0
pAAVS-EGFP^PTC-35
 
Resource Report
Resource Website
RRID:Addgene_254990 EGFP^PTC-35 Synthetic Ampicillin and Kanamycin PMID:32668236 Vector Backbone:hAAVS1-HYG-CMV-EGFP ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin NA Addgene 2026-09-26 02:54:49 0
pAAVS-EGFP^PTC-231
 
Resource Report
Resource Website
RRID:Addgene_254989 EGFP^PTC-231 Synthetic Ampicillin and Kanamycin PMID:32668236 Vector Backbone:hAAVS1-HYG-CMV-EGFP ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin NA Addgene 2026-09-26 02:54:49 0
pML104-KanMX-sgRNAv2
 
Resource Report
Resource Website
RRID:Addgene_254712 YKU70 sgRNA Saccharomyces cerevisiae Ampicillin and Kanamycin PMID:42519825 This plasmid contains an example guide sequence targeting **YKU70**. As described in our protocol paper, the guide sequence can be easily changed by designing forward and reverse primers for a new target and then using PCR and seamless plasmid recircularization. Backbone Marker:John Wyrick lab; Backbone Size:11240; Vector Backbone:pML104; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:55:32 0
pSK+KanaRpsL
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_20871 KanamycinResistance-RpsL E.coli Ampicillin and Kanamycin PMID:19160076 Backbone Size:2935; Vector Backbone:pBluescript SK+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin none Addgene 2026-09-26 02:29:56 10
pBlueKan+cysMPro
 
Resource Report
Resource Website
RRID:Addgene_187879 Ampicillin and Kanamycin PMID:35416085 Backbone Marker:Stratagene (Agilent Tech); Backbone Size:2864; Vector Backbone:pBluescript KS(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:42:10 0
Hm-tnn::Kaede
 
Resource Report
Resource Website
RRID:Addgene_176423 Kaede Ampicillin and Kanamycin PMID:34752780 Vector Backbone:pCRII-TOPO plasmid; Vector Types:Transgenesis in Hofstenia miamia; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:53:59 0
pNS2_Ptrc::luxI
 
Resource Report
Resource Website
RRID:Addgene_239010 Acyl-homoserine-lactone synthase, 3OC6-HSL Vibrio fischeri Ampicillin and Kanamycin PMID:40716565 Please visit https://doi.org/10.1101/2025.04.03.647055 for bioRxiv preprint. Backbone Size:9691; Vector Backbone:pAM1579; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:54:00 0
pSAM_Ec
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_102939 mariner transposon flanked by MmeI modified inverted repeats and the himar1C9 transposase Ampicillin and Kanamycin PMID:23990803 The Plac promoter from pGFP-Mut3.1 (Clonetech), along with its associated ribosome binding sequence, was amplified via PCR. Engineered 59 BamHI and 39 NdeI restriction sites were used to sub-clone the resulting fragment into a BamHI/NdeI (New England Biolabs) double digested pSAM_Bt vector upstream of the himar1C9 transposase gene. The kanamycin resistance gene from pKD4 was amplified and ligated using the restriction sites MfeI and XbaI, replacing the erythromycin resistance gene ermG in pSAM_Bt. The resulting transposon mutagenesis vector, pSAM-Ec, was stored and propagated in the pir+ E. coli strain EcS17. Vector Backbone:pSAM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:18:31 3
LSB-hsa-miR-127-3p
 
Resource Report
Resource Website
RRID:Addgene_103194 hsa-miR-127-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:18:33 0
LSB-hsa-miR-1271-5p
 
Resource Report
Resource Website
RRID:Addgene_103196 hsa-miR-1271-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:18:33 0
LSB-hsa-miR-1185-1-3p
 
Resource Report
Resource Website
RRID:Addgene_103180 hsa-miR-1185-1-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:18:33 0
LSB-hsa-miR-1185-2-3p
 
Resource Report
Resource Website
RRID:Addgene_103181 hsa-miR-1185-2-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:18:33 0
LSB-hsa-miR-10a-3p
 
Resource Report
Resource Website
RRID:Addgene_103176 hsa-miR-10a-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:18:33 0
LSB-hsa-miR-10b-5p
 
Resource Report
Resource Website
RRID:Addgene_103179 hsa-miR-10b-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:18:33 0
LSB-hsa-miR-10b-3p
 
Resource Report
Resource Website
RRID:Addgene_103178 hsa-miR-10b-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:18:33 0
LSB-hsa-miR-107
 
Resource Report
Resource Website
RRID:Addgene_103175 hsa-miR-107 target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:18:33 0
LSB-hsa-miR-125b-5p
 
Resource Report
Resource Website
RRID:Addgene_103191 hsa-miR-125b-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:18:33 0
LSB-hsa-miR-126-3p
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_103192 hsa-miR-126-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:18:33 1
LSB-hsa-miR-125a-3p
 
Resource Report
Resource Website
RRID:Addgene_103187 hsa-miR-125a-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin Addgene 2026-09-26 02:18:33 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.