Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
p2attNG-H11-long Resource Report Resource Website 1+ mentions |
RRID:Addgene_51545 | GFP4m | Ampicillin and Kanamycin | PMID:24304893 | Vector Backbone:p2attNG; Vector Types:Mammalian Expression, Human Targeting; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:16:14 | 1 | |||
|
pLKO.1-puro U6 sgRNA BfuAI large stuffer Resource Report Resource Website 10+ mentions |
RRID:Addgene_52628 | Kanamycin cassette | Bacterial origin | Ampicillin and Kanamycin | This is a second generation plasmid that increases the efficiency of sgRNA guide cloning over the original "pLKO.1-puro U6 sgRNA BspMI stuffer" vector. "pLKO.1-puro U6 sgRNA BfuAI large stuffer" was created to simplify the cloning of the sgRNA guide cassette into pLKO.1-puro U6 sgRNA BspMI stuffer vector originally described in the manuscript “Kearns, NA, etal. Development 2014, 141(1):219-23”. The original vector has a small intervening sequence that presents two problems: 1) the efficiency of excision by BfuAI is moderate, and 2) the size of this spacer is similar to the guide sequence, which makes distinguishing positive clones from reclosures challenging. Consequently, we have inserted a Kanamycin cassette between these sites at a unique Bcl1 site. This element is more efficiently excised by BfuAI and makes distinguishing vectors containing the desired guide sequence easy to distinguish from the parent vector. The excision of the Kan cassette by BfuAI cuts this cassette into 3 fragments due to two internal BfuAI sites within the Kan cassette. Otherwise the cloning of the guides is carried out as described in the manuscript. | Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:16:24 | 23 | ||
|
pKIKOlacZKm Resource Report Resource Website 1+ mentions |
RRID:Addgene_46767 | Ampicillin and Kanamycin | PMID:23799955 | This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between lacZ homologous arms and integrated at the lacZ locus. | Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:15:35 | 1 | |||
|
pKIKOarsBKm Resource Report Resource Website 1+ mentions |
RRID:Addgene_46766 | Ampicillin and Kanamycin | PMID:23799955 | This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between arsB homologous arms and integrated at the arsB locus. | Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:15:35 | 5 | |||
|
pCR2.1-Ins2-842 Resource Report Resource Website |
RRID:Addgene_53969 | mouse Ins2 gene partial | Mus musculus | Ampicillin and Kanamycin | PMID:23144715 | Backbone Marker:Life Technologies; Vector Backbone:pCR2.1-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:16:35 | 0 | ||
|
pCR2.1-INS-904 Resource Report Resource Website |
RRID:Addgene_53970 | human INS gene partial | Homo sapiens | Ampicillin and Kanamycin | PMID:23144715 | Backbone Marker:Life Technologies; Vector Backbone:pCR2.1-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:16:35 | 0 | ||
|
pGuide Resource Report Resource Website 10+ mentions |
RRID:Addgene_64711 | Streptococcus pyogenes guide RNA | Synthetic | Ampicillin and Kanamycin | PMID:23561441 | Backbone Marker:Invitrogen; Backbone Size:3979; Vector Backbone:pCRII-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:18:12 | 15 | ||
|
pUC18R6KT-mini-Tn7T-Km Resource Report Resource Website 1+ mentions |
RRID:Addgene_64969 | Ampicillin and Kanamycin | PMID:15908923 | The uncut plasmid runs as a multimer (>10kb). Multimerization often does not impact plasmid function, but may reduce transformation efficiencies. If the monomer is needed, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid. | Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18R6KT-mini-Tn7T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:18:14 | 5 | |||
|
SEPTOPO Resource Report Resource Website |
RRID:Addgene_64944 | SEP | Synthetic | Ampicillin and Kanamycin | PMID:24403083 | Note that the coding sequence for SEP is lacking a start codon. | Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:18:15 | 0 | |
|
pFKM1 Resource Report Resource Website |
RRID:Addgene_64950 | FRT-KmR-FRT | Ampicillin and Kanamycin | PMID:15908923 | GenBank Accession #AY597272 Compared to the Genbank reference sequence AY597272, Addgene's sequencing results found N18I, R145C and D146N mutations in the kanamycin cassette. The effect of these differences is unknown. | Backbone Marker:Herbert Schweizer; Vector Backbone:pFRT2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:18:14 | 0 | ||
|
pSEVA12DKR-E Resource Report Resource Website |
RRID:Addgene_58305 | Genomic cassette | Synthetic | Ampicillin and Kanamycin | PMID:24847673 | Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:15 | 0 | ||
|
pSEVA12DKR-A Resource Report Resource Website |
RRID:Addgene_58304 | Genomic cassette | Synthetic | Ampicillin and Kanamycin | PMID:24847673 | Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:15 | 0 | ||
|
pSEVA12TEC-B Resource Report Resource Website |
RRID:Addgene_58307 | Genomic cassette | Synthetic | Ampicillin and Kanamycin | PMID:24847673 | Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:15 | 0 | ||
|
pT2SK Resource Report Resource Website |
RRID:Addgene_59383 | TT-ISceI-kan | Synthetic | Ampicillin and Kanamycin | PMID:25255806 | iGEM parts BBa_B1002 and BBa_B1006 were used to build the double terminator element. The kanamycin resistance gene was taken from pACYC177. We developed GetX (https://sourceforge.net/projects/getx/), a stand-alone python script that allows the user to design mutation cassettes for scarless genome editing in bacteria using our previously described two-step recombination method. Please see the document linked under the Resource Information heading above for additional information on installing and using the script. | Backbone Marker:Copley Lab; Backbone Size:1887; Vector Backbone:pHA1887, an 1887 bp fragment extending from bp 690 to bp 2576 of pUC19 (Acc. No. M77789); Vector Types:template; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:23 | 0 | |
|
pBAM1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_60487 | Ampicillin and Kanamycin | PMID:21342504 | Backbone Size:4384; Vector Backbone:pBAM1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:32 | 3 | ||||
|
pEP-EGFPin Resource Report Resource Website 1+ mentions |
RRID:Addgene_60961 | eGFP-Kana_I-SceI | Ampicillin and Kanamycin | PMID:16526409 | Vector Backbone:pEGFP N1; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:37 | 2 | |||
|
eGFPbait-E2A-KalTA4-pA donor vector Resource Report Resource Website 1+ mentions |
RRID:Addgene_61069 | eGFPbait | Synthetic | Ampicillin and Kanamycin | PMID:24179142 | The eGFPbait-E2A-KalTA4 donor plasmid was generated by forward insertion of a PCR-amplified eGFP fragment into the pCRII-TOPO vector. Primers used were eGFP_fwd: ATAGTGGTACCATGGTGAGCAAGGGCGAGGAGC, and eGFP_rev: GTAGCGGCTGAAGCACTGCACGC. The E2A-KalTA4-pA fragment was generated by fusion of individual PCR products using Phusion High-Fidelity DNA Polymerase (Thermo Scientific); E2A was amplified with the primers E2A_fwd: TGCAGATATCCAGGAGGAGGACAGTGTACTAATTATGCTC, E2A_rev: TTCCTCCTCCGGGACCTGGGTTGCTC from a previously generated E2A sequence (Szymczak et al. 2004, PMID 15064769). KalTA4-pA was amplified with KalTA4_fwd: CCCAGGTCCCGGAGGAGGAAAACTGCTC, KalTA4_rev: CATGCTCGAGTCCACTAGTTCTAGAGCG, using the 4 × Kaloop vector as template (Distel et al. 2009, PMID 19628697). Subsequently, both fragments were fused, amplified, and inserted into pCRII-TOPO-eGFPbait with EcoRV and XhoI. | Backbone Marker:Invitrogen; Vector Backbone:pCRII-TOPO; Vector Types:zebrafish expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:39 | 1 | |
|
pCRII_TOPO_hNEAT1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61518 | NEAT1 | Homo sapiens | Ampicillin and Kanamycin | PMID:19217333 | *To create this plasmid, hNEAT1 was amplified from HeLa cDNA. The insert contains two mismatches (C->T at bp 78, and A->G at bp 91, an A->G at bp 1666, and a deletion of TA at bp 2031 and 2032 using the numbering of NR_028272.1) compared to the canonical hNEAT1 sequence. These variants are likely to be encoded in the HeLa genome, as they appeared in multiple clones, but this is yet to be verified by sequencing of HeLa genomic DNA. | Backbone Marker:Life Technologies; Backbone Size:4000; Vector Backbone:PCRII; Vector Types:general cloning vector; Bacterial Resistance:Ampicillin and Kanamycin | *see comment below | 2026-08-15 01:17:43 | 6 |
|
pEPkan-S2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61601 | Kana_I-SceI | Ampicillin and Kanamycin | PMID:16526409 | Vector Backbone:pcDNA3; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:44 | 2 | |||
|
UQ6139 Resource Report Resource Website |
RRID:Addgene_37177 | coxM1′::lacZ reporter system with higher-affinity RcoM1 binding site at the "e" position AND RcoM1 with C-term 6xHIS | Burkholderia xenovorans | Ampicillin and Kanamycin | This is Roberts lab strain UQ5853 (Addgene #37159) containing Roberts lab plasmids pUX3242 (pUX2996 with a coxM1′::lacZ reporter system such that ...vector DNA – BamHI (unique site) – higher-affinity binding site at the “e” position (“e↑” binding site = 5′-TCCTACAGTTCACGCACGT-3′) – coxM1′(with unique SalI site)::lacZ-> tfd <-KanR (with 5′-end unique XhoI site) – vector DNA <-SpR...) AND pUX2410 (for expression of Burkholderia xenovorans RcoM1 protein + C-terminal 6×His tag). The strain is CmR, pUX3242 is KanR and SpecR and pUX2410 is AmpR. Can be grown in Amp + Kan. For strain usage see attached pdf. | Vector Backbone:pUX3242 and pUX2410; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:14:13 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.