Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAAV-CaMKIIa-oChIEF(E163A/T199C)-P2A-mKate2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_51092 | oChIEF(E163A/T199C) | Synthetic | Ampicillin | The addition of the E163A and T199C mutations in oChIEF impart higher photocurrent amplitude while retaining fast kinetic properties. This variant is proposed as an alternative to ChETA variants that exhibit smaller photocurrents and more toxicity. | Backbone Marker:custom; Backbone Size:5100; Vector Backbone:pAAV-CaMKIIa-WPRE-HGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | E163A/T199C | 2026-08-15 01:16:14 | 1 | |
|
pSIR-DsRed-Express2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_51135 | Ampicillin | PMID:25051498 | Backbone Marker:Clontech; Backbone Size:8089; Vector Backbone:pSIR; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:11 | 2 | ||||
|
hUbc13 Resource Report Resource Website 1+ mentions |
RRID:Addgene_51131 | ubc13 | Homo sapiens | Ampicillin | PMID:22367539 | Backbone Marker:Novagen; Backbone Size:5800; Vector Backbone:PETSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:14 | 4 | ||
|
pET28a-SrtAdelta59 Resource Report Resource Website 1+ mentions |
RRID:Addgene_51138 | S.aureus SrtA delta 59 | S.aureus | Kanamycin | PMID:23989673 | Backbone Marker:Novagen; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:14 | 6 | ||
|
pICSL11024 (pICH47732::NOSp-NPTII-OCST) Resource Report Resource Website 10+ mentions |
RRID:Addgene_51144 | NOSp-NPTII-OCST | Synthetic | Ampicillin | Backbone Marker:Sylvestre Marillonnet; Vector Backbone:pICH47732; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:14 | 22 | |||
|
pSLQ1661-sgMUC4-E3(F+E) Resource Report Resource Website 1+ mentions |
RRID:Addgene_51025 | optimized sgRNA | Homo sapiens | Ampicillin | PMID:24360272 | gRNA target sequence GTGGCGTGACCTGTGGATGCTG | Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:13 | 8 | |
|
pSLQ1651-sgTelomere(F+E) Resource Report Resource Website 10+ mentions |
RRID:Addgene_51024 | Optimized sgRNA | Homo sapiens | Ampicillin | PMID:24360272 | gRNA target sequence GTTAGGGTTAGGGTTAGGGTTA | Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 18 | |
|
pICSL11017 (pICH47732::NOSp-BAR-NOST) Resource Report Resource Website 1+ mentions |
RRID:Addgene_51145 | NOSp-BAR-NOST | Synthetic | Ampicillin | Backbone Marker:Sylvestre Marillonnet; Vector Backbone:pICH47732; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:11 | 1 | |||
|
pCAG-hCas9 Resource Report Resource Website 10+ mentions |
RRID:Addgene_51142 | hCas9 | Kanamycin | PMID:24084724 | Backbone Marker:clontech; Backbone Size:5800; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:11 | 12 | |||
|
pet30b-7M SrtA Resource Report Resource Website 10+ mentions |
RRID:Addgene_51141 | S.aureus SrtA 7M | S.aureus | Kanamycin | Backbone Marker:Novagen; Backbone Size:5421; Vector Backbone:pET30b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | P94R, E105K, E108Q, D160N, D165A, K190E, K196T | 2026-08-15 01:16:14 | 20 | ||
|
AAV-oChIEF-tdTomato Resource Report Resource Website 1+ mentions |
RRID:Addgene_50977 | ChIEF-tdTomato | Synthetic | Ampicillin | PMID:19254539 | Backbone Size:4599; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin | ChIEF gene is mammalian codon optimized | 2026-08-15 01:16:13 | 8 | |
|
Human Lentiviral sgRNA Library - Kinases Resource Report Resource Website 1+ mentions |
RRID:Addgene_51044 | sgRNA library (enriched for kinase targets) | Homo sapiens | Ampicillin | PMID:24336569 | The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters. IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below. | Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:13 | 4 | |
|
Human Lentiviral sgRNA Library - Nuclear Resource Report Resource Website 1+ mentions |
RRID:Addgene_51047 | sgRNA library (enriched for nuclear targets) | Homo sapiens | Ampicillin | PMID:24336569 | The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters. IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below. | Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:13 | 8 | |
|
Human Lentiviral sgRNA Library - Unknown Function Resource Report Resource Website 1+ mentions |
RRID:Addgene_51043 | sgRNA library (enriched for genes of unknown function) | Homo sapiens | Ampicillin | PMID:24336569 | The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters. IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below. | Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 2 | |
|
pBABEpuro-gateway Resource Report Resource Website 10+ mentions |
RRID:Addgene_51070 | Chloramphenicol and Ampicillin | PMID:22908275 | Backbone Size:6900; Vector Backbone:pBABEpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:16:13 | 18 | ||||
|
AAV-EF1a-DIO-GCaMP6f-P2A-nls-dTomato Resource Report Resource Website 10+ mentions |
RRID:Addgene_51083 | GCaMP6f | Synthetic | Ampicillin | The addition of the P2A-nls-dTomato allows for easy identification of GCaMP6 expressing cells exhibiting nuclear red fluorescence that does not significantly overlap with the cytosolic GCaMP signal. The GCaMP and fluorophore are physically uncoupled. Permissions were obtained from Douglas Kim and the Clontech licensing office for depositing this new plasmid. | Backbone Marker:custom; Backbone Size:5320; Vector Backbone:pAAV-EF1a-DIO-WPRE-BGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:11 | 10 | ||
|
AAV-EF1a-DIO-GCaMP6s-P2A-nls-dTomato Resource Report Resource Website 10+ mentions |
RRID:Addgene_51082 | GCaMP6s | Synthetic | Ampicillin | The addition of the P2A-nls-dTomato allows for easy identification of GCaMP6 expressing cells exhibiting nuclear red fluorescence that does not significantly overlap with the cytosolic GCaMP signal. The GCaMP and fluorophore are physically uncoupled. Permissions were obtained from Douglas Kim and the Clontech licensing office for depositing this new plasmid. | Backbone Marker:custom; Backbone Size:5320; Vector Backbone:pAAV-EF1a-DIO-WPRE-BGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:14 | 10 | ||
|
pH2B-EYFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_51002 | H2B-EYFP | Homo sapiens | Kanamycin | Please note that the H2B sequence in this plasmid was derived from H2B-GFP (Addgene plasmid# 11680) and contains the same differences (D26G and V119I) compared to GenBank reference sequences, such as NP_066402.2. | Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:13 | 2 | ||
|
AAV-hSyn1-GCaMP6f-P2A-nls-dTomato Resource Report Resource Website 10+ mentions |
RRID:Addgene_51085 | GCaMP6f | Synthetic | Ampicillin | The addition of the P2A-nls-dTomato allows for easy identification of GCaMP6 expressing cells exhibiting nuclear red fluorescence that does not significantly overlap with the cytosolic GCaMP signal. The GCaMP and fluorophore are physically uncoupled. Permissions were obtained from Douglas Kim and the Clontech licensing office for depositing this new plasmid. | Backbone Marker:Modified from Karl Deisseroth; Backbone Size:4590; Vector Backbone:pAAV-hSyn1-WPRE-HGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:14 | 17 | ||
|
AAV-CaMKIIa-GCaMP6f-P2A-nls-dTomato Resource Report Resource Website 1+ mentions |
RRID:Addgene_51087 | GCaMP6f | Synthetic | Ampicillin | The addition of the P2A-nls-dTomato allows for easy identification of GCaMP6 expressing cells exhibiting nuclear red fluorescence that does not significantly overlap with the cytosolic GCaMP signal. The GCaMP and fluorophore are physically uncoupled. Permissions were obtained from Douglas Kim and the Clontech licensing office for depositing this new plasmid. | Backbone Marker:custom; Backbone Size:5095; Vector Backbone:pAAV-CaMKIIa-WPRE-BGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:11 | 6 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
