Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
EJ808 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007126 | Caenorhabditis elegans | gem-4(dx77) IV. | No apparent phenotype. Suppressor of gon-2(q388). | WBGene00001577(gem-4) | WBGene00001577(gem-4) | WB-STRAIN:WBStrain00007126 | WormBase (WB) | WB | available | WB-STRAIN:EJ808, CGC_EJ808 | WormBase | 2026-09-26 11:22:11 | 0 | |||
|
EL302 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007147 | Caenorhabditis elegans | ego-1(om71) unc-29(e193)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III. | Heterozygotes are WT and segregate WT, Sterile Uncs and Dpys. bli-4 is suppressed by dpy-18 in hT2 homozygotes-only see a very few DpyBli. | WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001214(ego-1)|WBGene00006765(unc-29) | WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001214(ego-1), WBGene00006765(unc-29) | WB-STRAIN:WBStrain00007147 | WormBase (WB) | WB | available | PMID:8647392 | WB-STRAIN:EL302, CGC_EL302 | WormBase | 2026-09-26 11:22:11 | 0 | ||
|
EL301 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007146 | Caenorhabditis elegans | lag-1(om13) IV. | Temperature sensitive; best grown at 15C. Lab and embryonic Mel phenotypes. | WBGene00002245(lag-1) | WBGene00002245(lag-1) | WB-STRAIN:WBStrain00007146 | WormBase (WB) | WB | available | PMID:8647392 | WB-STRAIN:EL301, CGC_EL301 | WormBase | 2026-09-26 11:22:11 | 0 | ||
|
EL129 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007143 | Caenorhabditis elegans | ego-3(om40) unc-76(e911) V/nT1 [unc-?(n754) let-?] (IV;V). | Heterozygotes are Unc and segregate additional hets, Unc-76 om40 homozygotes and dead eggs. om40 animals have multiple germline defects. | WBGene00001216(ego-3)|WBGene00006808(unc-76) | WBGene00001216(ego-3), WBGene00006808(unc-76) | WB-STRAIN:WBStrain00007143 | WormBase (WB) | WB | available | PMID:8647392 | WB-STRAIN:EL129, CGC_EL129 | WormBase | 2026-09-26 11:22:11 | 0 | ||
|
EKM42 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007141 | Caenorhabditis elegans | unc-119(ed3) III; cldIs5. | cldIs5 [pie-1p::capg-1::GFP + unc-119(+)]. GFP tagged CAPG-1 driven by the pie-1 promoter; expression is detected in the germline and in embryos. References: Collette K, et al. J Cell Sci. 2011 Nov 1;124(Pt 21):3684-94. Bembenek JN, et al. Curr Biol. 2013 Jun 3;23(11):937-46. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00007141 | WormBase (WB) | WB | available | WB-STRAIN:EKM42, CGC_EKM42 | WormBase | 2026-09-26 11:22:11 | 0 | |||
|
EKM11 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007140 | Caenorhabditis elegans | htz-1(tm2469) IV/nT1 [qIs51] (IV;V). | Made_by: G. Csankovszki|"Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2469 homozygotes (Sterile). tm2469 m+z- are sterile adults. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al. (2009) Curr Biol 19(1):9-19."|"Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2469 homozygotes (Sterile). tm2469 m+z- are sterile adults. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Petty EL, et al. PLoS Genet. 2009 Oct;5(10):e1000699. doi: 10.1371/journal.pgen.1000699. Csankovszki G, et al. (2009) Curr Biol 19(1):9-19. [NOTE: new stock received at CGC 05/26/2021. Original stock received in 2010 had broken down and was no longer segregating as expected.]"|"Mutagen:TMP+UV"|"Mutagen:TMP/UV"|"No longer available from the CGC catalogue 24/04/2020" | WBGene00019947(htz-1) | WBGene00019947(htz-1) | WB-STRAIN:WBStrain00007140 | WormBase (WB) | WB | available | WB-STRAIN:EKM11, CGC_EKM11 | WormBase | 2026-09-26 11:22:11 | 0 | |||
|
EM81 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007157 | Caenorhabditis elegans | him-5(e1490) V; ram-5(bx30) X. | Lumpy rays.|"Made_by: Baird S" | WBGene00001864(him-5)|WBGene00004301(ram-5) | WBGene00001864(him-5), WBGene00004301(ram-5) | WB-STRAIN:WBStrain00007157 | WormBase (WB) | WB | available | PMID:10899109 | WB-STRAIN:EM81, CGC_EM81 | WormBase | 2026-09-26 11:22:11 | 0 | ||
|
EM68 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007156 | Caenorhabditis elegans | col-34(bx25) IV; him-5(e1490) V. | Lumpy rays. Temperature sensitive. bx25 previously called ram-4.|"Made_by: Baird S" | WBGene00000611(col-34)|WBGene00001864(him-5) | WBGene00000611(col-34), WBGene00001864(him-5) | WB-STRAIN:WBStrain00007156 | WormBase (WB) | WB | available | WB-STRAIN:EM68, CGC_EM68 | WormBase | 2026-09-26 11:22:11 | 0 | |||
|
EM67 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007155 | Caenorhabditis elegans | mab-20(bx24) I; him-5(e1490) V. | Extensive ray fusion. Posterior portion of body swollen at larval stages. | WBGene00001864(him-5)|WBGene00003111(mab-20) | WBGene00001864(him-5), WBGene00003111(mab-20) | WB-STRAIN:WBStrain00007155 | WormBase (WB) | WB | available | PMID:1782863 | WB-STRAIN:EM67, CGC_EM67 | WormBase | 2026-09-26 11:22:11 | 0 | ||
|
EM62 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007153 | Caenorhabditis elegans | mab-17(e2167) unc-15(e73) I; him-5(e1490) V. | Unc. Round bulging adult male tale. Very reduced fan. Mating efficiency is zero. | WBGene00001864(him-5)|WBGene00003109(mab-17)|WBGene00006754(unc-15) | WBGene00001864(him-5), WBGene00003109(mab-17), WBGene00006754(unc-15) | WB-STRAIN:WBStrain00007153 | WormBase (WB) | WB | available | WB-STRAIN:EM62, CGC_EM62 | WormBase | 2026-09-26 11:22:11 | 0 | |||
|
EL391 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007150 | Caenorhabditis elegans | ego-1(om84) unc-29(e193)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III. | Heterozygotes are WT and segregate WT, mild Unc that are Sterile, and Dpys. bli-4 is suppressed by dpy-18 in hT2 homozygotes-only see a very few DpyBli.|"Made_by: Spoerke/Maine" | WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001214(ego-1)|WBGene00006765(unc-29) | WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001214(ego-1), WBGene00006765(unc-29) | WB-STRAIN:WBStrain00007150 | WormBase (WB) | WB | available | PMID:10704412 | WB-STRAIN:EL391, CGC_EL391 | WormBase | 2026-09-26 11:22:11 | 0 | ||
|
EL329 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007149 | Caenorhabditis elegans | ego-1(om58)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III. | Heterozgyotes are WT and segregate WT, Steriles and Dpys. The Steriles produce small, abnormal oocytes; some dead embryos are produced in late adulthood. bli-4 is suppressed by dpy-1 in hT2 homozygotes-only see a very few DpyBli. om58 previously called ego-6(om58). | WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001214(ego-1) | WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001214(ego-1) | WB-STRAIN:WBStrain00007149 | WormBase (WB) | WB | available | WB-STRAIN:EL329, CGC_EL329 | WormBase | 2026-09-26 11:22:11 | 0 | |||
|
EM139 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007168 | Caenorhabditis elegans | ram-1(bx34) I; him-5(e1490) V. | Lumpy rays.|"Made_by: Baird S" | WBGene00001864(him-5)|WBGene00004299(ram-1) | WBGene00001864(him-5), WBGene00004299(ram-1) | WB-STRAIN:WBStrain00007168 | WormBase (WB) | WB | available | WB-STRAIN:EM139, CGC_EM139 | WormBase | 2026-09-26 11:22:12 | 0 | |||
|
EN5273 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007201 | Caenorhabditis elegans | (kr5273) X. | Mos1 transposon insertion in LG X. Presence of Mos1 can be detected using oligos oJL115 (Mos1 5'gctcaattcgcgccaaactatg3') and oVR266 (Chr X 5'gacaaagacgtgtagttgcg3'). Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22. | WB-STRAIN:WBStrain00007201 | WormBase (WB) | WB | available | WB-STRAIN:EN5273, CGC_EN5273 | WormBase | 2026-09-26 11:22:12 | 0 | |||||
|
EM122 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007165 | Caenorhabditis elegans | stDp2 (X;II)/+ II; him-5(e1490) V; unc-18(e81) dpy-6(e14) X. | Strain throws WT, DpyUncs and males (and some Lon-don't know where these come from??). Maintain by picking WT. non-Unc non-Dpy males mate at low frequency and will transmit stDp2. | WBGene00001068(dpy-6)|WBGene00001864(him-5)|WBGene00006757(unc-18) | WBGene00001068(dpy-6), WBGene00001864(him-5), WBGene00006757(unc-18) | WB-STRAIN:WBStrain00007165 | WormBase (WB) | WB | available | PMID:6537930 | WB-STRAIN:EM122, CGC_EM122 | WormBase | 2026-09-26 11:22:11 | 0 | ||
|
EM116 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007164 | Caenorhabditis elegans | mab-25(bx27) I; him-5(e1490) V. | Temperature sensitive. Missing Ray. Swollen tail and reduced fan. Temperature sensitive lethal at all stages. Wrinkled spicule. | WBGene00001864(him-5)|WBGene00003116(mab-25) | WBGene00001864(him-5), WBGene00003116(mab-25) | WB-STRAIN:WBStrain00007164 | WormBase (WB) | WB | available | WB-STRAIN:EM116, CGC_EM116 | WormBase | 2026-09-26 11:22:11 | 0 | |||
|
EM113 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007163 | Caenorhabditis elegans | dpy-10(e128) ram-2(bx32) II; him-5(e1490) V. | Dpy. Abnormal rays.|"Made_by: Baird S" | WBGene00001072(dpy-10)|WBGene00001864(him-5)|WBGene00004300(ram-2) | WBGene00001072(dpy-10), WBGene00001864(him-5), WBGene00004300(ram-2) | WB-STRAIN:WBStrain00007163 | WormBase (WB) | WB | available | WB-STRAIN:EM113, CGC_EM113 | WormBase | 2026-09-26 11:22:11 | 0 | |||
|
EM106 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007161 | Caenorhabditis elegans | lin-41(bx42) I; him-5(e1490) V. | Maintain under normal conditions. Males have long tail tips. | WBGene00001864(him-5)|WBGene00003026(lin-41) | WBGene00001864(him-5), WBGene00003026(lin-41) | WB-STRAIN:WBStrain00007161 | WormBase (WB) | WB | available | WB-STRAIN:EM106, CGC_EM106 | WormBase | 2026-09-26 11:22:11 | 0 | |||
|
EM105 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007160 | Caenorhabditis elegans | mab-21(bx41) III; him-5(e1490) V. | Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Body is slightly shorter. | WBGene00001864(him-5)|WBGene00003112(mab-21) | WBGene00001864(him-5), WBGene00003112(mab-21) | WB-STRAIN:WBStrain00007160 | WormBase (WB) | WB | available | PMID:1782863 | WB-STRAIN:EM105, CGC_EM105 | WormBase | 2026-09-26 11:22:11 | 0 | ||
|
EM101 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007159 | Caenorhabditis elegans | lin-41(bx37)I; him-5(e1490)V. | Maintain under normal conditions. Males have long tail tips. | WBGene00001864(him-5)|WBGene00003026(lin-41) | WBGene00001864(him-5), WBGene00003026(lin-41) | WB-STRAIN:WBStrain00007159 | WormBase (WB) | WB | available | WB-STRAIN:EM101, CGC_EM101 | WormBase | 2026-09-26 11:22:11 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
