Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
JH1576 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022255 | Caenorhabditis elegans | unc-119(ed3) III; axIs1140. | axIs1140 [pie-1p::GFP::mbk-2 + unc-119(+)]. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00022255 | WormBase (WB) | WB | available | WB-STRAIN:JH1576, CGC_JH1576 | WormBase | 2026-10-24 11:02:33 | 0 | |||
|
JH1766 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022258 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00004027(pie-1) | WBGene00004027(pie-1) | WB-STRAIN:WBStrain00022258 | WormBase (WB) | WB | unknown | WB-STRAIN:JH1766 | WormBase | 2026-10-24 11:02:33 | 0 | |||
|
JH2221 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022290 | Caenorhabditis elegans | unc-119(ed3) III; axIs1609. | axIs1609 [pie-1p::GFP::histone H2B::mex-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00022290 | WormBase (WB) | WB | available | WB-STRAIN:JH2221, CGC_JH2221 | WormBase | 2026-10-24 11:02:33 | 0 | |||
|
JH2223 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022291 | Caenorhabditis elegans | unc-119(ed3) III; axIs1611. | axIs1611 [pie-1p::GFP::histone H2B::daz-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00022291 | WormBase (WB) | WB | available | WB-STRAIN:JH2223, CGC_JH2223 | WormBase | 2026-10-24 11:02:33 | 0 | |||
|
JCP152 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022204 | Caenorhabditis elegans | dpy-11(e224) ccz-1(t2129) V; jcpEx2. | jcpEx2 [ced-1p::F58G11.6(genomic)::YFP::let-858 3'UTR + unc-119(+) + myo-2::GFP]. Maintain by picking GFP+. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7. | WBGene00001073(dpy-11)|WBGene00010283(ccz-1) | WBGene00001073(dpy-11), WBGene00010283(ccz-1) | WB-STRAIN:WBStrain00022204 | WormBase (WB) | WB | available | WB-STRAIN:JCP152, CGC_JCP152 | WormBase | 2026-10-24 11:02:32 | 0 | |||
|
JCP301 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022207 | Caenorhabditis elegans | jcpSi3 II; unc-119(ed3) III. | jcpSi3 [ins-37p::ins-37::eGFP::ins-37 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gmez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.|"Made_by: Knudra Nemametrix" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00022207 | WormBase (WB) | WB | available | WB-STRAIN:JCP301, CGC_JCP301 | WormBase | 2026-10-24 11:02:32 | 0 | |||
|
JCP294 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022206 | Caenorhabditis elegans | ints-6(t1903) IV. | Made_by: Ralf Schnabel, Juan Cabello|"Temperature-sensitive. Grows well at 15C; embryonic lethal at 25C. ints-6 previously known as dic-1. Reference: Gmez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981." | WBGene00000994(ints-6) | WBGene00000994(ints-6) | WB-STRAIN:WBStrain00022206 | WormBase (WB) | WB | available | WB-STRAIN:JCP294, CGC_JCP294 | WormBase | 2026-10-24 11:02:32 | 0 | |||
|
JCP343 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022209 | Caenorhabditis elegans | jcpSi12 II; unc-119(ed3) III. | jcpSi12 [W04G5.8p::W04G5.8::eGFP::W04G5.8 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gmez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.|"Made_by: Knudra Nemametrix" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00022209 | WormBase (WB) | WB | available | WB-STRAIN:JCP343, CGC_JCP343 | WormBase | 2026-10-24 11:02:32 | 0 | |||
|
JH2184 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022285 | Caenorhabditis elegans | unc-119(ed3) III; axIs1595. | axIs1595 [pie-1p::GFP::npp-9(orf )::npp-9 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Voronina E & Seydoux G, Development. 2010 May;137(9):1441-50.|"Made_by: E Voronina"|"Supplementary_genotype GFP-NPP-9; axIs1595 [pie-1p:GFP:npp-9(orf):npp-9 3UTR + unc-119(+)]" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00022285 | WormBase (WB) | WB | available | PMID:37467327 PMID:37505984 PMID:37995185 PMID:39167497 |
WB-STRAIN:JH2184, CGC_JH2184 | WormBase | 2026-10-24 11:02:33 | 0 | ||
|
JH2220 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022289 | Caenorhabditis elegans | unc-119(ed3) III; axIs1608. | axIs1608 [pie-1p::GFP::histone H2B::par-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00022289 | WormBase (WB) | WB | available | WB-STRAIN:JH2220, CGC_JH2220 | WormBase | 2026-10-24 11:02:33 | 0 | |||
|
JCM1 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022202 | Caenorhabditis elegans | hyl-2(gnv1) X. | gnv1 was found in strain AT10. hyl-2(+):CATCAT: aagcgcagtgatttctggcaaatgcttgttcatcattttatcaccctcgcacttattgg tgtttca; hyl-2(gnv1): CAATAT: aagcgcagtgatttctggcaaatgcttgttcaatattttatcaccctcgcacttattgg tgtttca. Anoxia sensitive. Heat-shock (36 deg Celcius) sensitive. | WBGene00002044(hyl-2) | WBGene00002044(hyl-2) | WB-STRAIN:WBStrain00022202 | WormBase (WB) | WB | available | WB-STRAIN:JCM1, CGC_JCM1 | WormBase | 2026-10-24 11:02:32 | 0 | |||
|
JH2163 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022281 | Caenorhabditis elegans | unc-119(ed3) III; axIs1564. | axIs1564 [pie-1p::GFP::fog-2 ORF::fog-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00022281 | WormBase (WB) | WB | available | WB-STRAIN:JH2163, CGC_JH2163 | WormBase | 2026-10-24 11:02:33 | 0 | |||
|
JH2162 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022280 | Caenorhabditis elegans | unc-119(ed3) III; axIs1563. | axIs1563 [pie-1p::GFP::cep-1 ORF::cep-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00022280 | WormBase (WB) | WB | available | WB-STRAIN:JH2162, CGC_JH2162 | WormBase | 2026-10-24 11:02:33 | 0 | |||
|
JH2107 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022273 | Caenorhabditis elegans | unc-119(ed3) III; axIs1720. | axIs1720 [pie-1p::GFP::pgl-1 ORF::pgl-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00022273 | WormBase (WB) | WB | available | WB-STRAIN:JH2107, CGC_JH2107 | WormBase | 2026-10-24 11:02:33 | 0 | |||
|
JE1111 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022227 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00002081(ina-1) | WBGene00002081(ina-1) | WB-STRAIN:WBStrain00022227 | WormBase (WB) | WB | unknown | WB-STRAIN:JE1111 | WormBase | 2026-10-24 11:02:32 | 0 | |||
|
JD740 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022226 | Caenorhabditis elegans | avr-14(ad1302) I; avr-15(ad1051) V. | Modest ivermectin resistance. Mild feeding defect. Lacks M3 neurotransmission. Reference: Dent JA, et al. Proc Natl Acad Sci U S A. 2000 Mar 14;97(6):2674-9. | WBGene00000232(avr-14)|WBGene00000233(avr-15) | WBGene00000232(avr-14), WBGene00000233(avr-15) | WB-STRAIN:WBStrain00022226 | WormBase (WB) | WB | available | WB-STRAIN:JD740, CGC_JD740 | WormBase | 2026-10-24 11:02:32 | 0 | |||
|
JE2222 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022229 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00003929(pat-2) | WBGene00003929(pat-2) | WB-STRAIN:WBStrain00022229 | WormBase (WB) | WB | unknown | WB-STRAIN:JE2222 | WormBase | 2026-10-24 11:02:32 | 0 | |||
|
JE2121 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022228 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00003929(pat-2) | WBGene00003929(pat-2) | WB-STRAIN:WBStrain00022228 | WormBase (WB) | WB | unknown | WB-STRAIN:JE2121 | WormBase | 2026-10-24 11:02:32 | 0 | |||
|
JD255 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022221 | Caenorhabditis elegans | gar-3(lg1201) V; gar-1(ad1676) X. | Pharyngeal pumping anomalies. Arecoline resistance. Locomotion variant. Reference: Steger KA & Avery L. Genetics. 2004 Jun;167(2):633-43. | WBGene00001517(gar-1)|WBGene00001519(gar-3) | WBGene00001517(gar-1), WBGene00001519(gar-3) | WB-STRAIN:WBStrain00022221 | WormBase (WB) | WB | available | WB-STRAIN:JD255, CGC_JD255 | WormBase | 2026-10-24 11:02:32 | 0 | |||
|
JD600 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00022224 | Caenorhabditis elegans | avr-15(ad1051) glc-1(pk54) V. | Slow pumping. This strain is a replacement for the strain DA1370 whose genotype is actually avr-15(vu227) glc-1(pk54) V. Reference: Dent et al., 2000, Proc. Nat. Acad. Sci. 97(6): 2674-2679. | WBGene00000233(avr-15)|WBGene00001591(glc-1) | WBGene00000233(avr-15), WBGene00001591(glc-1) | WB-STRAIN:WBStrain00022224 | WormBase (WB) | WB | available | WB-STRAIN:JD600, CGC_JD600 | WormBase | 2026-10-24 11:02:32 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
