Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
zyg-9(or1956[gfp::zyg-9]) II; ltIs37 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050673 | Caenorhabditis elegans | zyg-9(or1956[gfp::zyg-9]) II; ltIs37 IV. | itIs37 [pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV. GFP tag inserted into endogenous zyg-9 locus. Might still contain unc-119(ed3) in the background. Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020|"ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous zyg-9 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020" | WBGene00006994(zyg-9) | WBGene00006994(zyg-9) | WB-STRAIN:WBStrain00050673 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:15 | 0 | ||||
|
gwIs39 gwIs34 unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050678 | Caenorhabditis elegans | gwIs39 gwIs34 unc-119(ed3) III. | gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs34 [myo-3::mCherry + 256xlacO + unc-119(+)] III. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a small spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364 | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00050678 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:17 | 0 | ||||
|
nlp-8(syb762) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050711 | Caenorhabditis elegans | nlp-8(syb762) IV. | Made_by: Marina Sinner /SunyBiotech|"syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791" | WBGene00003746(nlp-8) | WBGene00003746(nlp-8) | WB-STRAIN:WBStrain00050711 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:20 | 0 | ||||
|
frSi21 II; frIs7 IV; rde-1(ne300) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050716 | Caenorhabditis elegans | frSi21 II; frIs7 IV; rde-1(ne300) V. | frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454|"frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the inserted vector but outside the genomic rde-1 sequence included in the transgene (jep3108: ATcttgtgaccgaactgtcc) in combination with downstream primer (jep2445: caaaaaggcgggatgagcag), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. Reference: https:" | WBGene00004323(rde-1) | WBGene00004323(rde-1) | WB-STRAIN:WBStrain00050716 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:14 | 0 | ||||
|
osIs158 II; ieSi58 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050714 | Caenorhabditis elegans | osIs158 II; ieSi58 IV. | Made_by: Takefumi Negishi|"osIs158 [eft-3p::ccvTIR-1(F79G)::mRuby] single copy inserted into ttTi5605 on LG II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218."|"osIs158 [eft-3p::ccvTIR-1(F79G)::mRuby] single copy inserted into ttTi5605 on LG II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Yesbolatova A, et al. Nat Commun. 2020 Nov 11;11(1):5701." | WB-STRAIN:WBStrain00050714 | WormBase (WB) | WB | unknown | PMID:34865044 | WormBase | 2026-10-31 09:56:17 | 0 | |||||
|
cshIs128 II; ieSi58 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050713 | Caenorhabditis elegans | cshIs128 II; ieSi58 IV. | cshIs128 [rps-28p::TIR1::T2A::mCherry::his-11 + Cbr-unc-119(+)] II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. Companion strain to HML1012. Harbors conventional allele of TIR1 and Nuclear localized mCherry co-expression marker.|"Made_by: Nat" | WB-STRAIN:WBStrain00050713 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:16 | 0 | ||||||
|
wrdSi46 I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050719 | Caenorhabditis elegans | wrdSi46 I. | wrdSi46 [SCMp*::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Seam cell-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in seam cell nuclei. Some expression in hypodermal cells. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541|"wrdSi46[SCMp*::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR] I:-5.32 Seam cell-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in seam cell nuclei. Some expression in hypodermal cells. Reference Ashley et al., 2020" | WB-STRAIN:WBStrain00050719 | WormBase (WB) | WB | unknown | PMID:38839826 | WormBase | 2026-10-31 09:56:20 | 0 | |||||
|
ncs-2(ju836) Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050660 | Caenorhabditis elegans | ncs-2(ju836) | Superficially wild-type. Reference: Zhou K, et al. Cell Reports 2017 May 9;19(6):1117-1129. PMID: 28494862 | WBGene00003564(ncs-2) | WBGene00003564(ncs-2) | WB-STRAIN:WBStrain00050660 | WormBase (WB) | WB | unknown | PMID:38530893 | WormBase | 2026-10-31 09:56:12 | 0 | |||
|
uqIs5. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050662 | Caenorhabditis elegans | uqIs5. | uqIs5 [lbp-2p::lbp-2::TagRFP]. Age-dependent aggregation of LBP-2::TagRFP in the pseudocoelom. Reference: Gallotta I, et al. Nature. 2020 Jul 8. doi: 10.1038/s41586-020-2461-z. | WB-STRAIN:WBStrain00050662 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:16 | 0 | ||||||
|
rab-8(tm2526) I; muIs32 II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050661 | Caenorhabditis elegans | rab-8(tm2526) I; muIs32 II. | muIs32 [mec-7p::GFP + lin-15(+)]. Homozygous viable. Reference: Kim KW, et al. Elife. 2018 Nov 21;7:e39756. doi: 10.7554/eLife.39756. PMID: 30461420 | WBGene00004272(rab-8) | WBGene00004272(rab-8) | WB-STRAIN:WBStrain00050661 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:15 | 0 | ||||
|
goeIs397. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050701 | Caenorhabditis elegans | goeIs397. | goeIs397 [hsp-16.2p::cnc-10::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-10::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791|"Made_by: Florentin Masurat" | WB-STRAIN:WBStrain00050701 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:16 | 0 | ||||||
|
bmdSi170 I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050667 | Caenorhabditis elegans | bmdSi170 I. | bmdSi170 [loxN::eft-3p::his-58::GFP::3xHA] I. Superficially wild-type. bmdSi170 is a single-copy CRISPR/Cas9-engineered insertion of HIS-58 C-terminally tagged with non-codon-optimized GFP and driven by the ubiquitous eft-3 promoter. Reference: Azmi MA, et al. bioRxiv 2020.10.17.344069; doi: https: | WB-STRAIN:WBStrain00050667 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:19 | 0 | ||||||
|
bmdSi141 I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050666 | Caenorhabditis elegans | bmdSi141 I. | bmdSi141 [loxN::eft-3p::his-58::GFP] I. Slow growing. Maintain at 15-20C. bmdSi141 is a single-copy CRISPR/Cas9-engineered insertion of HIS-58 C-terminally tagged with codon-optimized GFP and driven by the ubiquitous eft-3 promoter. Reference: Azmi MA, et al. bioRxiv 2020.10.17.344069; doi: https: | WB-STRAIN:WBStrain00050666 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:16 | 0 | ||||||
|
bmdSi147 I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050665 | Caenorhabditis elegans | bmdSi147 I. | bmdSi147 [loxN::rps-27p::DHB::2xmKate2::P2A::H2B::GFP] I. bmdSi147 is a single-copy CRISPR/Cas9-engineered insertion of a codon-optimized CDK sensor (amino acids 9941087 of human DNA Helicase B (DHB) fused to two copies of mKate2) co-expressed with his-58 (H2B) fused to GFP. Reference: Adikes RC, et al. Visualizing the metazoan proliferation-terminal differentiation decision in vivo. bioRxiv 2019.12.18.881888|"Made_by: Taylor N. Medwig-Kinney" | WB-STRAIN:WBStrain00050665 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:15 | 0 | ||||||
|
goeIs413. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050709 | Caenorhabditis elegans | goeIs413. | goeIs413 [hsp-16.2p::cnc-9::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-9::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791|"Made_by: Florentin Masurat" | WB-STRAIN:WBStrain00050709 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:16 | 0 | ||||||
|
goeIs412. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050708 | Caenorhabditis elegans | goeIs412. | goeIs412 [hsp-16.2p::cnc-7::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-7::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791|"Made_by: Florentin Masurat" | WB-STRAIN:WBStrain00050708 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:13 | 0 | ||||||
|
goeIs411. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050707 | Caenorhabditis elegans | goeIs411. | goeIs411 [hsp-16.2p::cnc-4::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-4::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791|"Made_by: Florentin Masurat" | WB-STRAIN:WBStrain00050707 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:20 | 0 | ||||||
|
mir-1022(umn51[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050650 | Caenorhabditis elegans | mir-1022(umn51[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272]) X. | Made_by: Julie Knott & Marcus Vargas|"mir-1022 pre-miRNA deletion allele in which mir-1022 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]" | WBGene00003514(myo-2)|WBGene00005016(sqt-1)|WBGene00077721(mir-1022) | WBGene00003514(myo-2), WBGene00005016(sqt-1), WBGene00077721(mir-1022) | WB-STRAIN:WBStrain00050650 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:16 | 0 | ||||
|
rpl-29(tm3555) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050657 | Caenorhabditis elegans | rpl-29(tm3555) IV. | Homozygous viable Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376. | WBGene00004443(rpl-29) | WBGene00004443(rpl-29) | WB-STRAIN:WBStrain00050657 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:15 | 0 | ||||
|
ebax-1(ju699) IV; juEx1434. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050654 | Caenorhabditis elegans | ebax-1(ju699) IV; juEx1434. | juEx1434 [rgef-1p::ebax-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. juEx1434 rescues Egl of pqn-55(ju699) mutants. Reference: Wang Z., et al. Neuron. 2013 Sep 4;79(5):903-16. | WBGene00004140(ebax-1) | WBGene00004140(ebax-1) | WB-STRAIN:WBStrain00050654 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:16 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
