Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
dhs-28(ldr6) X; ldrIs1; ldrIs2. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050738 | Caenorhabditis elegans | dhs-28(ldr6) X; ldrIs1; ldrIs2. | ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr6 is G-to-A causing a G158E substitution. Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The G158E substitution site of the ldr6 mutant is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276|"ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr6 is G158A (Gly-Arg). Super-sized lipid droplets. Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276" | WBGene00000991(dhs-28) | WBGene00000991(dhs-28) | WB-STRAIN:WBStrain00050738 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:18 | 0 | ||||
|
pha-1(e2123) III; otEx7225. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050843 | Caenorhabditis elegans | pha-1(e2123) III; otEx7225. | otEx7225 [eat-5(fosmid WRM0621dG04)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050843 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:23 | 0 | ||||
|
otIs439; hdIs32. Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00050842 | Caenorhabditis elegans | otIs439; hdIs32. | Made_by: Oliver Hobert Lab|"otIs439 [lad-2p::GFP + pha-1(+)]. hdIs32 [glr-1::DsRed2]. SMD neurons are labeled with GFP and DsRed2. Can be used to isolate SMD by FACS. Used by CeNGEN project for RNA-Seq (https:" | WB-STRAIN:WBStrain00050842 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:20 | 1 | ||||||
|
pha-1(e2123) III; otEx7121. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050841 | Caenorhabditis elegans | pha-1(e2123) III; otEx7121. | otEx7121 [inx-3(fosmid WRM0636dA10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050841 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:19 | 0 | ||||
|
pha-1(e2123) III; otEx7292. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050848 | Caenorhabditis elegans | pha-1(e2123) III; otEx7292. | otEx7292 [inx-7(fosmid WRM0631dH08)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050848 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:16 | 0 | ||||
|
inx-2(ot906 [inx-2::SL2::NLS::yfp::H2B]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050847 | Caenorhabditis elegans | inx-2(ot906 [inx-2::SL2::NLS::yfp::H2B]) X. | inx-2(ot906) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-2 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00002124(inx-2) | WBGene00002124(inx-2) | WB-STRAIN:WBStrain00050847 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:23 | 0 | ||||
|
pha-1(e2123) III; otEx7233. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050846 | Caenorhabditis elegans | pha-1(e2123) III; otEx7233. | otEx7233 [inx-19(extended fosmid WRM0632bE10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050846 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:20 | 0 | ||||
|
pha-1(e2123) III; otEx7232. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050845 | Caenorhabditis elegans | pha-1(e2123) III; otEx7232. | otEx7232 [inx-15(fosmid WRM0619cH12)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050845 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:20 | 0 | ||||
|
otEx7294. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050849 | Caenorhabditis elegans | otEx7294. | otEx7294 [inx-8(fosmid WRM0632dA04)::SL2::NLS::YFP::H2B + rol-6(su1006)]. Pick Rollers to maintain. | WB-STRAIN:WBStrain00050849 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:20 | 0 | ||||||
|
pha-1(e2123) III; otEx7113. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050838 | Caenorhabditis elegans | pha-1(e2123) III; otEx7113. | otEx7113 [inx-12(fosmid WRM0621dC07)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050838 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:20 | 0 | ||||
|
Y55B1BR.1(sy1201) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050890 | Caenorhabditis elegans | Y55B1BR.1(sy1201) III. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCCRight flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00021911(affl-1) | WBGene00021911(affl-1) | WB-STRAIN:WBStrain00050890 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:21 | 0 | ||||
|
nlp-77(sy1216) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050895 | Caenorhabditis elegans | nlp-77(sy1216) II. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-77; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GACAACCAGCCGGAGGTCAAGATGTTCCACCATTCRight flanking sequence: CTTCGTAATGCCACTCCAGCTCAACTTCAGAGCTTCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAAMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WB-STRAIN:WBStrain00050895 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:24 | 0 | ||||||
|
nlp-76(sy1214) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050894 | Caenorhabditis elegans | nlp-76(sy1214) X. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-76; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: cagTGTTCATCGCAATCTGCGTGCTCTCCCAAAARight flanking sequence: CGCTATGGCCCTCCGTGGTGCACTATTCCGTTCTGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CACGGAGGGCCATAGCGTTTMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00045386(nlp-76) | WBGene00045386(nlp-76) | WB-STRAIN:WBStrain00050894 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:21 | 0 | ||||
|
pals-16(sy1207) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050892 | Caenorhabditis elegans | pals-16(sy1207) III. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GGAATCATTGACAAATTGCAGAACATCAACACCTTRight flanking sequence: Ggtaggttgaagaagttattattggaatttgaaatinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAGAACATCAACACCTTGGTMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00022337(pals-16) | WBGene00022337(pals-16) | WB-STRAIN:WBStrain00050892 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:17 | 0 | ||||
|
col-135(sy1435) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050932 | Caenorhabditis elegans | col-135(sy1435) IV. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-135. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: CCAGCGCTCGGGTATAATATTCGATATCCCTCCTright flanking sequence: ATGAACCAAATCGACAATATGGCCCATATTCGAATGinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGTCGATTTGGTTCATAGGMethod Reference: G3 (Bethesda)."|"Supplementary_genotype col-135(sy1435)" | WBGene00000708(col-135) | WBGene00000708(col-135) | WB-STRAIN:WBStrain00050932 | WormBase (WB) | WB | unknown | PMID:37541249 | WormBase | 2026-10-31 09:56:18 | 0 | |||
|
Y62F5A.10(sy1222) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050898 | Caenorhabditis elegans | Y62F5A.10(sy1222) II. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y62F5A.10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GAAGAAGAAGATAACACGGAAGGAGAAATCCAACARight flanking sequence: CCGCACTGAACAAAACAGCATCCAACGACGATCTTCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTTTTGTTCAGTGCGGTGTMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00013388(Y62F5A.10) | WBGene00013388(Y62F5A.10) | WB-STRAIN:WBStrain00050898 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:21 | 0 | ||||
|
affl-2(sy975) Y55B1BR.1(sy1220) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050897 | Caenorhabditis elegans | affl-2(sy975) Y55B1BR.1(sy1220) III. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1 into sup-45 mutant (sy975);Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCCRight flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1 into sup-45 mutant (sy975);Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCCRight flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. affl-2 formerly known as sup-45." | WBGene00021911(affl-1)|WBGene00021912(affl-2) | WBGene00021911(affl-1), WBGene00021912(affl-2) | WB-STRAIN:WBStrain00050897 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:21 | 0 | ||||
|
oac-2(sy1218) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050896 | Caenorhabditis elegans | oac-2(sy1218) V. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: aattgtggaatttttagATTTCGAAGAATCCTCCCRight flanking sequence: GCTGTACTACTTGACCATCTTCCTCATAGTAGTCATGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAAMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00044088(oac-2) | WBGene00044088(oac-2) | WB-STRAIN:WBStrain00050896 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:18 | 0 | ||||
|
nlp-9(sy1451) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050935 | Caenorhabditis elegans | nlp-9(sy1451) V. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-9. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: gaaaaaaagagagATGGATCGATTCGCCACCAGATright flanking sequence: TTATCGCCCTTCTTCTGGTTCTTTTACAAATTGgtginserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGAAGAAGGGCGATAAATCMethod Reference: G3 (Bethesda)." | WBGene00003747(nlp-9) | WBGene00003747(nlp-9) | WB-STRAIN:WBStrain00050935 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:25 | 0 | ||||
|
nlp-6(sy1449) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050934 | Caenorhabditis elegans | nlp-6(sy1449) X. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: GCGACTCGCCTTCGTTCTTCTCGTCTCGGCGTGCGright flanking sequence: TCATGGCAATGGCTGCTCCAAAACAAATGGTGTTCinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCTCGTCTCGGCGTGCGTCAMethod Reference: G3 (Bethesda)." | WBGene00003744(nlp-6) | WBGene00003744(nlp-6) | WB-STRAIN:WBStrain00050934 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:22 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
