Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
C45G3.3(gk5549[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051918 | Caenorhabditis elegans | C45G3.3(gk5549[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. | Made_by: Morgan Zaic|"umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5549 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4477 and CGC92. gk5549 is a 1227 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTTTTGAACGCTCGCGCCACAATGTCATA; Right flanking sequence: ATTTTCCCTTGTTCTCTTGCTCACAGTAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00000254(bli-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000254(bli-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051918 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:44 | 0 | ||||
|
ehs-1(syb4426[ehs-1::SL2::GFP::H2B]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051861 | Caenorhabditis elegans | ehs-1(syb4426[ehs-1::SL2::GFP::H2B]) II. | Made_by: SUNY Biotech|"SL2::GFP::H2B tag inserted at the C-terminus of the endogenous ehs-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341"|"SL2::GFP::H2B tag inserted at the C-terminus of the endogenous ehs-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341" | WBGene00001224(ehs-1) | WBGene00001224(ehs-1) | WB-STRAIN:WBStrain00051861 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:39 | 0 | ||||
|
nekl-4(my51[nekl-4::mNeonGreen]) III; him-5(e1490) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051867 | Caenorhabditis elegans | nekl-4(my51[nekl-4::mNeonGreen]) III; him-5(e1490) V. | Made_by: Kaiden Power|"mNeonGreen tag inserted into endogenous nekl-4 locus by CRISPR/Cas9 engineering. Very faint mNeonGreen expression in the dendrites, soma, and axons of all ciliated neurons. Reference: Power KM, et al. PLoS Genet. 2020 Oct 16;16(10):e1009052. PMID: 33064774" | WBGene00001864(him-5)|WBGene00017033(nekl-4) | WBGene00001864(him-5), WBGene00017033(nekl-4) | WB-STRAIN:WBStrain00051867 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:44 | 0 | ||||
|
F10B5.2(gk5455[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051900 | Caenorhabditis elegans | F10B5.2(gk5455[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. | Made_by: Morgan Zaic|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5455 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4374 and CGC48. gk5455 is a 2246 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACTGCGATCTTGCTTCAAGCTATGCGAATG. Right flanking sequence: TCCGAGACTCTGCACACGCCGGTGATGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006787(unc-52)|WBGene00006789(unc-54) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006787(unc-52), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051900 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:40 | 0 | ||||
|
tpan-1(syb5349[tpan-1::GFP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051866 | Caenorhabditis elegans | tpan-1(syb5349[tpan-1::GFP]) V. | GFP tag inserted at the C-terminus of the endogenous tpan-1 locus by CRISPR. Allele generated by SUNY Biotech.|"Made_by: SUNY Biotech" | WBGene00012853(tpan-1) | WBGene00012853(tpan-1) | WB-STRAIN:WBStrain00051866 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:42 | 0 | ||||
|
ceh-38(syb4799[ceh-38::GFP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051864 | Caenorhabditis elegans | ceh-38(syb4799[ceh-38::GFP]) II. | GFP tag inserted at the C-terminus of the endogenous ceh-38 locus by CRISPR. Allele generated by SUNY Biotech.|"Made_by: SUNY Biotech" | WBGene00000459(ceh-38) | WBGene00000459(ceh-38) | WB-STRAIN:WBStrain00051864 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:39 | 0 | ||||
|
tars-1(gk5534[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051903 | Caenorhabditis elegans | tars-1(gk5534[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. | Made_by: Morgan Zaic|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5534 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4460 and CGC48. gk5534 is a 2908 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTCAATGCATTAGAAGACGTGGGCGCGT. Right flanking sequence: TACGGGAGAGGCAGAGTGCACAGAGGAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006617(tars-1)|WBGene00006787(unc-52)|WBGene00006789(unc-54) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006617(tars-1), WBGene00006787(unc-52), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051903 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:45 | 0 | ||||
|
glb-4(gk5468[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051902 | Caenorhabditis elegans | glb-4(gk5468[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. | Made_by: Morgan Zaic|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5468 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4390 and CGC48. gk5468 is a 5263 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGGAACATACTTCTTCGTCGATATGGAGTA; Right flanking sequence: ATGTACTACATGTTTTCGATGTGTAGATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006787(unc-52)|WBGene00006789(unc-54)|WBGene00007502(glb-4) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006787(unc-52), WBGene00006789(unc-54), WBGene00007502(glb-4) | WB-STRAIN:WBStrain00051902 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:43 | 0 | ||||
|
fxSi1 I; spe-44(fx123[spe-44::degron]) IV; fog-2(fx111) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051868 | Caenorhabditis elegans | fxSi1 I; spe-44(fx123[spe-44::degron]) IV; fog-2(fx111) V. | fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. Degron tag was inserted into the endogenous spe-44 locus in the JU2526 wild isolate background, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Reference: Kasimatis, KR et al. (2020) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https:|"Made_by: Katja Kasimatis and Megan Moerdyk-Schauwecker" | WBGene00001482(fog-2)|WBGene00007732(spe-44) | WBGene00001482(fog-2), WBGene00007732(spe-44) | WB-STRAIN:WBStrain00051868 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:40 | 0 | ||||
|
pno-1(gk5573[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051907 | Caenorhabditis elegans | pno-1(gk5573[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. | Made_by: Morgan Zaic|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5573 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4502 and CGC48. gk5573 is a 3472 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACTGAATGGGTGAAGGGGCACTATATTGG. Right flanking sequence: TTTGGAGCAGTGTCCAAATTTTGCTCGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006787(unc-52)|WBGene00006789(unc-54)|WBGene00013144(pno-1) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006787(unc-52), WBGene00006789(unc-54), WBGene00013144(pno-1) | WB-STRAIN:WBStrain00051907 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:45 | 0 | ||||
|
sap-49(gk5542[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051905 | Caenorhabditis elegans | sap-49(gk5542[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. | Made_by: Morgan Zaic|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5542 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4469 and CGC48. gk5542 is a 1365 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGTGACTAATTAGTTTTGGTGTGTCCTCCG. Right flanking sequence: GACGTTCCCGAATCAACATCTCTCATGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00004723(sap-49)|WBGene00006787(unc-52)|WBGene00006789(unc-54) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00004723(sap-49), WBGene00006787(unc-52), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051905 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:40 | 0 | ||||
|
flp-14(syb3323[flp-14::T2A::3xNLS::GFP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051854 | Caenorhabditis elegans | flp-14(syb3323[flp-14::T2A::3xNLS::GFP]) III. | Endogenous flp-14 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.|"Supplementary_genotype flp-14(syb3323[flp-14::T2A::3xNLS::GFP]) III" | WBGene00001457(flp-14) | WBGene00001457(flp-14) | WB-STRAIN:WBStrain00051854 | WormBase (WB) | WB | unknown | PMID:37935195 | WormBase | 2026-10-31 09:56:42 | 0 | |||
|
nova-1(syb4373[nova-1::GFP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051859 | Caenorhabditis elegans | nova-1(syb4373[nova-1::GFP]) V. | GFP tag inserted at the C-terminus of the endogenous nova-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341|"GFP tag inserted at the C-terminus of the endogenous nova-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341"|"Made_by: SUNY Biotech" | WBGene00013347(nova-1) | WBGene00013347(nova-1) | WB-STRAIN:WBStrain00051859 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:44 | 0 | ||||
|
flp-26(syb3588[flp-26::T2A::3xNLS::GFP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051858 | Caenorhabditis elegans | flp-26(syb3588[flp-26::T2A::3xNLS::GFP]) X. | Endogenous flp-26 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.|"Supplementary_genotype flp-26(syb3588[flp-26::T2A::3xNLS::GFP]) X" | WBGene00020126(flp-26) | WBGene00020126(flp-26) | WB-STRAIN:WBStrain00051858 | WormBase (WB) | WB | unknown | PMID:37935195 | WormBase | 2026-10-31 09:56:42 | 0 | |||
|
eif-2D(syb3432[(delta)SUI1 domain +3xFLAG]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051857 | Caenorhabditis elegans | eif-2D(syb3432[(delta)SUI1 domain +3xFLAG]) II. | Endogenous eif-2D locus tagged with 3xFLAG. The SUI1 domain of the endogenous EIF-2D locus has been deleted and replaced with 3xFLAG via CRISPR/Cas9 gene editing. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821|"Made_by: Yoshifumi Sonobe" | WB-STRAIN:WBStrain00051857 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:39 | 0 | ||||||
|
pha-1(e2123) III; otEx7567. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051841 | Caenorhabditis elegans | pha-1(e2123) III; otEx7567. | Made_by: Tessa Tekieli|"otEx7567[nlp-56p::GFP + pha-1(+)]. RMG neurons are labeled with GFP. Can be used to isolate RMG by FACS. Used by CeNGEN project for RNA-Seq (https:" | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00051841 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:38 | 0 | ||||
|
otIs837. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051840 | Caenorhabditis elegans | otIs837. | Made_by: Marie Gendrel, Rebecca Stephen|"otIs837 [unc-25(prom3)(del1)::GFP]. RME neurons are labeled with GFP. Can be used to isolate RME by FACS. Used by CeNGEN project for RNA-Seq (https:" | WB-STRAIN:WBStrain00051840 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:39 | 0 | ||||||
|
ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V; ceh-14(ot1185) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051843 | Caenorhabditis elegans | ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V; ceh-14(ot1185) X. | Made_by: Eduardo Leyva-Diaz|"Null allele of ceh-14 generated by gRNAs targeted to the first and last exons, resulting in a 4056 bp deletion from +40 to +4096 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341"|"Null allele of ceh-14 generated by gRNAs targeted to the first and last exons, resulting in a 4056 bp deletion from +40 to +4096 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341" | WBGene00000438(ceh-14)|WBGene00004364(ric-4) | WBGene00000438(ceh-14), WBGene00004364(ric-4) | WB-STRAIN:WBStrain00051843 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:44 | 0 | ||||
|
ins-9(syb2616[ins-9::T2A::3xNLS::GFP]) X. Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00051847 | Caenorhabditis elegans | ins-9(syb2616[ins-9::T2A::3xNLS::GFP]) X. | Endogenous ins-9 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.|"Supplementary_genotype ins-9(syb2616[ins-9::T2A::3xNLS::GFP]) X" | WBGene00002092(ins-9) | WBGene00002092(ins-9) | WB-STRAIN:WBStrain00051847 | WormBase (WB) | WB | unknown | PMID:37935195 | WormBase | 2026-10-31 09:56:44 | 1 | |||
|
otIs736; evIs111. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051838 | Caenorhabditis elegans | otIs736; evIs111. | Made_by: Maryam Majeed (Hobert Lab)|"otIs736 [cat-4p::mCherry + rol-6(su1006)]. evIs111 [F25B3.3::GFP + dpy-20(+)]. Rollers. Pan-neural GFP expression. The two HSN neurons are marked with both GFP and mCherry. Can be used to isolate HSN by FACS. Used by CeNGEN project for RNA-Seq (https:" | WB-STRAIN:WBStrain00051838 | WormBase (WB) | WB | unknown | WormBase | 2026-10-31 09:56:42 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
