Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC1942 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036980 | Caenorhabditis elegans | F38H4.10(ok2146) IV/nT1 [qIs51] (IV;V). | F38H4.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2146 homozygotes (grotty, mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTCACCACTTCCCGTCTTC. External right primer: CGCATTTTCAGAATTTGGTG. Internal left primer: CAAAATGCGAATGGACAACA. Internal right primer: GGGAATCACAGAATTGGGAA. Internal WT amplicon: 2120 bp. Deletion size: 934 bp. Deletion left flank: ATTCTTTGAATGACTACTGTAGCGCCTGTG. Deletion right flank: GAAGAAACTGAACCATTACGGGAAATCATC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00009551(mob-1) | WBGene00009551(mob-1) | WB-STRAIN:WBStrain00036980 | WormBase (WB) | WB | available | WB-STRAIN:VC1942, CGC_VC1942 | WormBase | 2026-10-31 09:51:55 | 0 | |||
|
VC1945 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036982 | Caenorhabditis elegans | H08M01.1(ok2518) IV. | H08M01.1. External left primer: GCCTAGGATTCAGGTGGGAT. External right primer: TCATTGTGTGAACGAACGGT. Internal left primer: TGTTTCATGGGTTGGGAAAT. Internal right primer: TGATTGGGCATTCGAAAAAT. Internal WT amplicon: 3201 bp. Deletion size: 1630 bp. Deletion left flank: AAACTTTTTCGCAGCAATGACTTTTGGGGC. Deletion right flank: TCTGTGTTGGTGGATTTGGTCGCGCATCAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010373(H08M01.1) | WBGene00010373(H08M01.1) | WB-STRAIN:WBStrain00036982 | WormBase (WB) | WB | available | WB-STRAIN:VC1945, CGC_VC1945 | WormBase | 2026-10-31 09:51:55 | 0 | |||
|
VC1950 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036986 | Caenorhabditis elegans | K02B7.3(ok2382) II. | K02B7.3. External left primer: GCTAATCAGCGGAAAAGCAC. External right primer: TTAATGCCAACAAACCGTGA. Internal left primer: GATTTTCTATCGCTCTGCCG. Internal right primer: GAAATTTCCAGAAATGCCCA. Internal WT amplicon: 2157 bp. Deletion size: 1347 bp. Deletion left flank: GCGACTGTTTTCCAAAGTGCTCCTCTGTCG. Deletion right flank: TTTTGTGGAGAGTCTGAAAATTTTAAAATT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010491(K02B7.3) | WBGene00010491(K02B7.3) | WB-STRAIN:WBStrain00036986 | WormBase (WB) | WB | available | WB-STRAIN:VC1950, CGC_VC1950 | WormBase | 2026-10-31 09:51:55 | 0 | |||
|
VC1831 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036908 | Caenorhabditis elegans | vha-16(ok2332) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C30F8.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2332 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAGATCCAGGAAGGAATGA. External right primer: CGAAAATAATTGCAGCCCAT. Internal left primer: TTGCGAAGCCGATTTAGTTT. Internal right primer: TTCTTTCGCCTCCTTTTTCA. Internal WT amplicon: 2112 bp. Deletion size: 831 bp. Deletion left flank: TTTCGAAAAACCAGGCCGTAAACTGACAGC. Deletion right flank: TTTTTTTTCAAATTAAATTATTATACAACT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00016258(vha-16) | WBGene00000254(bli-4), WBGene00016258(vha-16) | WB-STRAIN:WBStrain00036908 | WormBase (WB) | WB | available | WB-STRAIN:VC1831, CGC_VC1831 | WormBase | 2026-10-31 09:51:53 | 0 | |||
|
VC1898 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036956 | Caenorhabditis elegans | Y66D12A.24&tin-10(ok2400) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Made_by: Anna Rankin|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y66D12A.22, Y66D12A.24. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2400 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGCTCACTTGACACTTTCG. External right primer: TGGGGAAAATCGAAAACTTG. Internal left primer: CTGTGCAATTTGTGATTGCC. Internal right primer: ATATGTACCGCCGAATGACC. Internal WT amplicon: 2686 bp. Deletion size: 1690 bp. Deletion left flank: TTCATTTTGGCTAATTTCTCAGTAAAAATT. Deletion right flank: TTCGATTTAAAAAAAATCGATTTTTTTCAC." | WBGene00000254(bli-4)|WBGene00006573(tin-10)|WBGene00013448(Y66D12A.24) | WBGene00000254(bli-4), WBGene00006573(tin-10), WBGene00013448(Y66D12A.24) | WB-STRAIN:WBStrain00036956 | WormBase (WB) | WB | available | WB-STRAIN:VC1898, CGC_VC1898 | WormBase | 2026-10-31 09:51:54 | 0 | |||
|
VC1902 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036958 | Caenorhabditis elegans | lgc-4(ok2567) X. | F18G5.4. External left primer: TATTCCATGATGGCGTCGTA. External right primer: CATGGTTGAGTGCAATGGTC. Internal left primer: TCAGGATCTGATGAATCCCC. Internal right primer: GCAGCGCTATCCGAGAATAC. Internal WT amplicon: 2935 bp. Deletion size: 2383 bp. Deletion left flank: ACTTGTAAAAATATGAAACGTATTTCAAAA. Deletion right flank: GCTATTTTTTAATCAGTCGCCTTCATTACA. Insertion Sequence: GGTGGTACTGACCAGAATTGCAGATCTACCAACGAGGCTATACGAATTGCAGGATTTGA TAACTTTGCTGATCAGCTCCAAGAATCCAATGGCGTTTTCGAAGCATGCCCAGAGGCCC ATTCAGAACAAGGAAATGAGAGTGAAGATTTTAAAGATTTGATCAATAGTGAAACTGAG TGCAACATTGAAGACGTTGTTCTCCCGACAGTACACGTTTCTACGGATTCTGAAGAAAT CATTTCGGGCGATGTGATTATGAATGGTTAGTAGATTGTTTAA.|"F18G5.4. External left primer: TATTCCATGATGGCGTCGTA. External right primer: CATGGTTGAGTGCAATGGTC. Internal left primer: TCAGGATCTGATGAATCCCC. Internal right primer: GCAGCGCTATCCGAGAATAC. Internal WT amplicon: 2935 bp. Deletion size: 2383 bp. Deletion left flank: ACTTGTAAAAATATGAAACGTATTTCAAAA. Deletion right flank: GCTATTTTTTAATCAGTCGCCTTCATTACA. Insertion Sequence: GGTGGTACTGACCAGAATTGCAGATCTACCAACGAGGCTATACGAATTGCAGGATTTGATAACTTTGCTGATCAGCTCCAAGAATCCAATGGCGTTTTCGAAGCATGCCCAGAGGCCCATTCAGAACAAGGAAATGAGAGTGAAGATTTTAAAGATTTGATCAATAGTGAAACTGAGTGCAACATTGAAGACGTTGTTCTCCCGACAGTACACGTTTCTACGGATTCTGAAGAAATCATTTCGGGCGATGTGATTATGAATGGTTAGTAGATTGTTTAA."|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00017580(lgc-4) | WBGene00017580(lgc-4) | WB-STRAIN:WBStrain00036958 | WormBase (WB) | WB | available | WB-STRAIN:VC1902, CGC_VC1902 | WormBase | 2026-10-31 09:51:54 | 0 | |||
|
VC1904 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036959 | Caenorhabditis elegans | hlh-34(gk1031) V. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T01D3.2. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 163 bp. Deletion left flank: TAAAAAACAGAAAAAAAATTAAAAATATAT. Deletion right flank: TTAAATCAAAAACTTAAAAGTTACCGAGTT. Insertion Sequence: TATA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011327(hlh-34) | WBGene00011327(hlh-34) | WB-STRAIN:WBStrain00036959 | WormBase (WB) | WB | available | WB-STRAIN:VC1904, CGC_VC1904 | WormBase | 2026-10-31 09:51:54 | 0 | |||
|
VC1894 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036952 | Caenorhabditis elegans | +/szT1 [lon-2(e678)] I; peb-1(ok1941)/szT1 X. | T14F9.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1941 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GCGTGAGCAGTATGCCACTA. External right primer: GCCTGGGTTCAACATAGCAT. Internal left primer: AATTTAGGGCTTCCTTCCCA. Internal right primer: GCTGAATGGTGGCTCAACTT. Internal WT amplicon: 1610 bp. Deletion size: 779 bp. Deletion left flank: CTAGCTTTTGAGAGTGTCTAAGGGAATTGT. Deletion right flank: AAACGAATGATGAAGTTTGAAGTTGATGTA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003056(lon-2)|WBGene00003968(peb-1) | WBGene00003056(lon-2), WBGene00003968(peb-1) | WB-STRAIN:WBStrain00036952 | WormBase (WB) | WB | available | WB-STRAIN:VC1894, CGC_VC1894 | WormBase | 2026-10-31 09:51:54 | 0 | |||
|
VC1895 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036953 | Caenorhabditis elegans | +/mT1 II; cyk-1(ok2300)/mT1 [dpy-10(e128)] III. | F11H8.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2300 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCAGCATTTCCTGTAGCACG. External right primer: CAAGATAATCAGGCGAAGGG. Internal left primer: CGGCTTCCTTTCTTGTTGAG. Internal right primer: CGGAATGCAAGCAGGATATT. Internal WT amplicon: 3243 bp. Deletion size: 826 bp. Deletion left flank: TTCAAAAATGTTCGGAATCCTTCAGATGCT. Deletion right flank: GCGGGGGTCCTCCGGTGATTGGAGGAAGAC. Insertion Sequence: TCGGAATCCTTCAGAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000872(cyk-1)|WBGene00001072(dpy-10) | WBGene00000872(cyk-1), WBGene00001072(dpy-10) | WB-STRAIN:WBStrain00036953 | WormBase (WB) | WB | available | WB-STRAIN:VC1895, CGC_VC1895 | WormBase | 2026-10-31 09:51:54 | 0 | |||
|
VC1923 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036969 | Caenorhabditis elegans | unc-22(gk3071) IV. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"unc-22 twitcher. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk3071), it is homozygous for 323 other mutations determined from sequence data. All mutations are annotated in WormBase." | WBGene00006759(unc-22) | WBGene00006759(unc-22) | WB-STRAIN:WBStrain00036969 | WormBase (WB) | WB | available | WB-STRAIN:VC1923, CGC_VC1923 | WormBase | 2026-10-31 09:51:55 | 0 | |||
|
VC1915 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036968 | Caenorhabditis elegans | klp-18(ok2519) IV/nT1 [qIs51] (IV;V). | C06G3.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2519 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTAAACTAGCGATGCCCG. External right primer: GAATTCCGTCCGAACCTTTT. Internal left primer: TCTTCAATCATTCACCGCTTT. Internal right primer: CGTCAACCTCTTGGCGTAGT. Internal WT amplicon: 1183 bp. Deletion size: 556 bp. Deletion left flank: TATGAGCTCCATCATATCTTTGATAGCTCT. Deletion right flank: GTCAAGGAAAGGTCATCTATCCTGAACCTT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00002228(klp-18) | WBGene00002228(klp-18) | WB-STRAIN:WBStrain00036968 | WormBase (WB) | WB | available | PMID:33713117 | WB-STRAIN:VC1915, CGC_VC1915 | WormBase | 2026-10-31 09:51:55 | 0 | ||
|
VC1905 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036960 | Caenorhabditis elegans | F21G4.5(gk1035) X. | F21G4.5. External left primer: TTGATGGAACTTTCATGGCA. External right primer: ATGATCTGAGATGAACGGGG. Internal left primer: CCTCTAAATGCCGACGTTGT. Internal right primer: TCCTGATCAATTGCAGCATC. Internal WT amplicon: 1653 bp. Deletion size: 444 bp. Deletion left flank: TTGCAGGTACATTTTCCTTGGTGAACATAA. Deletion right flank: ACTTTTTTCCATGTCTCCCACAACGTAAGT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00009026(F21G4.5) | WBGene00009026(F21G4.5) | WB-STRAIN:WBStrain00036960 | WormBase (WB) | WB | available | WB-STRAIN:VC1905, CGC_VC1905 | WormBase | 2026-10-31 09:51:54 | 0 | |||
|
VC1907 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036962 | Caenorhabditis elegans | Y97E10AR.7&rpb-9(gk1044) V/nT1 [qIs51] (IV;V). | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y97E10AR.5, Y97E10AR.7. Homozygous semi-sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk1044 homozygotes (often sterile or nearly sterile, can be maintained). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTATGAAGCTTAGCGCGGAC. External right primer: GACCATTGACACCTCGACCT. Internal left primer: TGCCAGAAGCATTGTACGAG. Internal right primer: GGATGGGTTAACTGGGATGA. Internal WT amplicon: 1933 bp. Deletion size: 931 bp. Deletion left flank: TAGACTGATTATGAGCATGTTTTAAAAAAT. Deletion right flank: TTTTGTTCCAACATTTTTAGTTTAAAATTA. Insertion Sequence: T." | WBGene00022400(rpb-9)|WBGene00022402(lmtr-2) | WBGene00022400(rpb-9), WBGene00022402(lmtr-2) | WB-STRAIN:WBStrain00036962 | WormBase (WB) | WB | available | WB-STRAIN:VC1907, CGC_VC1907 | WormBase | 2026-10-31 09:51:54 | 0 | |||
|
VC2133 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037101 | Caenorhabditis elegans | C11E4.7(gk3221) dhhc-1(gk1067) X. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1067) in F09B12.2, detectable by PCR using the following primers. External left primer: TGGTGGAGGTTTTCAAGGAG. External right primer: GCGTCATGGTGGGTAAAATC. Internal left primer: AAAGTGAACAGCGAAACGGT. Internal right primer: TAACTGGCAGCAGTGGTGAG. Internal WT amplicon: 1907 bp. Deletion size: 502 bp. Deletion left flank: TATAAGCCTGGCTGAAAGTTACGAATTTGG. Deletion right flank: AAAATTTGAATGAAATGTAAAGTTGAAGTA. Validation: gk1067 passed by diagnostic PCR, CGH. Other deletion (gk3221) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00007521(C11E4.7)|WBGene00008606(dhhc-1) | WBGene00007521(C11E4.7), WBGene00008606(dhhc-1) | WB-STRAIN:WBStrain00037101 | WormBase (WB) | WB | available | WB-STRAIN:VC2133, CGC_VC2133 | WormBase | 2026-10-31 09:51:57 | 0 | |||
|
VC2091 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037073 | Caenorhabditis elegans | C09H10.7(ok2381)/mIn1 [mIs14 dpy-10(e128)] II. | C09H10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2381 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAAATTTCCAGGTTCGTCGT. External right primer: TTCCTGTTCGAAACGAGGTT. Internal left primer: GTGGATGCTCCAACTGACAA. Internal right primer: TGACGATTTGAATGTCTGATACAA. Internal WT amplicon: 1330 bp. Deletion size: 456 bp. Deletion left flank: TTCAAAATGGAGTTTGATATCAAAAAAGTG. Deletion right flank: ATCAGAAGGAGAAGACGCATCGGATTTATA.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00003133(apc-1) | WBGene00001072(dpy-10), WBGene00003133(apc-1) | WB-STRAIN:WBStrain00037073 | WormBase (WB) | WB | available | WB-STRAIN:VC2091, CGC_VC2091 | WormBase | 2026-10-31 09:51:56 | 0 | |||
|
VC2093 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037074 | Caenorhabditis elegans | T15B7.2(ok2680) V/nT1 [qIs51] (IV;V). | T15B7.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2680 homozygotes (late larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCAGACGTATCTGGTTGCG. External right primer: AATGCAGCAGAGAGCGACTT. Internal left primer: ACAACGTGTTACAAATTTTAGGG. Internal right primer: GACTCCTCACGGATGACGAT. Internal WT amplicon: 1144 bp. Deletion size: 925 bp. Deletion left flank: TAATTTAAATTAATTTCAGATGGTCTGCAA. Deletion right flank: TATAAATAATAACACCAATATATGAGATTC. Insertion Sequence: ATC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020517(hpo-8) | WBGene00020517(hpo-8) | WB-STRAIN:WBStrain00037074 | WormBase (WB) | WB | available | PMID:37164154 | WB-STRAIN:VC2093, CGC_VC2093 | WormBase | 2026-10-31 09:51:56 | 0 | ||
|
VC2086 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037071 | Caenorhabditis elegans | nhr-237(gk1050) V. | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y46H3D.6. External left primer: TCGAATTGCATTTTGACAGC. External right primer: CGAAAAACAAGCAGCACAAA. Internal left primer: ACACGAATGCATAATTGCCA. Internal right primer: TACCGCCCAGTTTCAAGTTC. Internal WT amplicon: 2013 bp. Deletion size: 1085 bp. Deletion left flank: TCTGGGCTTCACTGATTGGGGTTAACGATT. Deletion right flank: CTTTATTAGACTCAAAGTTGTCTGAAAATA." | WBGene00021610(nhr-237) | WBGene00021610(nhr-237) | WB-STRAIN:WBStrain00037071 | WormBase (WB) | WB | available | WB-STRAIN:VC2086, CGC_VC2086 | WormBase | 2026-10-31 09:51:56 | 0 | |||
|
VC2101 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037077 | Caenorhabditis elegans | skp-1(ok2739) V. | F27F2.1. External left primer: TACGGATTGGAAAGCTCGAT. External right primer: AATGCTTCTGGCTTGTTGGT. Internal left primer: AACAAAATCTAACAGCCGCC. Internal right primer: TGAAAGATGCTCGCAAACAC. Internal WT amplicon: 3353 bp. Deletion size: 1242 bp. Deletion left flank: AGCACCTGCTCAATATATCAGATACACTCC. Deletion right flank: TTCATTTTTTCTAAATTTCGAACCGCCATA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00004806(skp-1) | WBGene00004806(skp-1) | WB-STRAIN:WBStrain00037077 | WormBase (WB) | WB | available | WB-STRAIN:VC2101, CGC_VC2101 | WormBase | 2026-10-31 09:51:56 | 0 | |||
|
VC2099 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037075 | Caenorhabditis elegans | mat-3(ok2476)/sC1 [dpy-1(s2170)] III. | F10C5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2476 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACTTTCGCCGTTTGATGTC. External right primer: CCGAAAATTAGCCGATTTGA. Internal left primer: TGATAAATGGTGTGCTCCGA. Internal right primer: GATTTATCCGTCAGCCGAAA. Internal WT amplicon: 2623 bp. Deletion size: 1324 bp. Deletion left flank: CTAAGGCCATAAAAATCAACAAAATCTAAA. Deletion right flank: TATTTAGCAGACCAAAGTTGGGTATCCAAT. Insertion Sequence: GAAAG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001063(dpy-1)|WBGene00003134(mat-3) | WBGene00001063(dpy-1), WBGene00003134(mat-3) | WB-STRAIN:WBStrain00037075 | WormBase (WB) | WB | available | WB-STRAIN:VC2099, CGC_VC2099 | WormBase | 2026-10-31 09:51:56 | 0 | |||
|
VC2100 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037076 | Caenorhabditis elegans | Y56A3A.2(ok2738) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y56A3A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2738 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTAAGCTCCGCCCATTTCT. External right primer: AACATCAATTTTGCCGGAAG. Internal left primer: GCTATTTCGCACTAAAATTGTTCA. Internal right primer: GAAGTTTCAATTCCGGCAAA. Internal WT amplicon: 1156 bp. Deletion size: 411 bp. Deletion left flank: ACGTTCGAATACACCTCCACCAGTCGGCAA. Deletion right flank: GTGCCAGAATTTGAATTTCCGGCAAATCGG." | WBGene00000254(bli-4)|WBGene00013225(Y56A3A.2) | WBGene00000254(bli-4), WBGene00013225(Y56A3A.2) | WB-STRAIN:WBStrain00037076 | WormBase (WB) | WB | available | WB-STRAIN:VC2100, CGC_VC2100 | WormBase | 2026-10-31 09:51:56 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
