Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 15 showing 281 ~ 300 out of 1,458 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_126790496

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126790496

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126790496
Notes: The Shank2 KO rat line 13 was generated by zinc finger nuclease technology targeting exon 31 for deletion . Line 13 has a 437 bp deletion around and including the entire exon 31, thereby causing a frameshift and premature stop codon in all three known isoforms of the rat Shank2 mRNA

Proper citation: RRID:RGD_126790496 Copy   


  • RRID:RGD_124713548

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=124713548

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 124713548
Notes: This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in 1bp deletion and caused premature stop at p266 of the Vdr gene. They were allowed food and water ad libitum and fed a CE-2 formula diet ( CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. The Vdr knock out rats for analysis were fed an F-2 formula diet (Oriental Yeast Co., Tokyo, Japan) containing 0.74% calcium and 2000 IU vitamin D/kg diet12 after weaning because the CE-2diet partially reversed their rickets symptoms. Homozygotes Vdr knock out mutants were maintained by mating of heterozygotes.

Proper citation: RRID:RGD_124713548 Copy   


  • RRID:RGD_13792606

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13792606

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13792606
Notes: The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion (TGCAAAACAAA) in exon 3. No protein expression was detected in the blood smear of homozygous mutants.

Proper citation: RRID:RGD_13792606 Copy   


  • RRID:RGD_21079475

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=21079475

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 21079475
Notes: The Lepr knockout rats were generated by CRISPR/Cas9. Two pairs of synthesized oligonucleotides for gRNA targeting on the exon 4 of Lepr, TAGGCAAATCATCTATAACTTC and AAACGAAGTTATAGATGATTTG; TAGGCTGAAAGCTGTCTTTCAG and AAACCTGAAAGACAGCTTTCAG were microinjected into Sprague Dawley (originally from Charles River) zygotes. The rat was genotyped by PCR with the primers, 5-prime-CTTGTGTCCAGAGCCTTCCTATAAC and 5-prime-ATTCCCCATGTTGTCTAGTAGTGATC. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. Founder 2 was chosen to establish a colony (designated as Lepr-/-), which carried a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA, deleting 997 amino acid of LEPR. Western blot analysis of total protein from liver tissue of the Lepr-/- rats confirmed the absence of LEPR.

Proper citation: RRID:RGD_21079475 Copy   


  • RRID:RGD_13792682

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13792682

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13792682
Notes: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.

Proper citation: RRID:RGD_13792682 Copy   


  • RRID:RGD_150429963

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429963

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150429963
Notes: The Pmch mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in exon 1(K50X) of Pmch in a rat. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU.

Proper citation: RRID:RGD_150429963 Copy   


  • RRID:RGD_13800749

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13800749

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13800749
Notes: CRISPR/Cas9 system was used to introduce a 84-bp deletion and skipping of exon 5 of the Glp1r gene in Lew/NCrl embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_13800749 Copy   


  • RRID:RGD_13825199

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13825199

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13825199
Notes: The Mc4r mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in helix 8 (K314X) of Mc4r. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU.

Proper citation: RRID:RGD_13825199 Copy   


  • RRID:RGD_14398825

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14398825

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 14398825
Notes: This strain was produced by injecting Sprague Dawley embryo with CRISPR/Cas9 system targeting the exon 2 of rat Fah gene. The resulting mutation is line 15 with a frameshift deletion causing Fah null in homozygotes. None of the Fah-/- newborns survived longer than three days after birth in the absence of NTBC. Upon NTBC addition to the drinking water, the Fah-/- rats underwent normal growth and were indistinguishable from their WT littermates.

Proper citation: RRID:RGD_14398825 Copy   


  • RRID:RGD_13825196

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13825196

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-11-21)
Alternate IDs: 13825196
Notes: CRISPR/Cas9 and two ssODNs (single-stranded oligodeoxynucleotide) were used to insert loxP sites flanking multiple exons

Proper citation: RRID:RGD_13825196 Copy   


  • RRID:RGD_150520211

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150520211

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown (as of 2021-11-09)
Alternate IDs: 150520211
Notes: Using CRISPR/Cas9, a 568bp region of the Pvt1 gene was deleted from the ACI genome including all of exon 3. This strain is maintained at Rat Resource and Research Center.

Proper citation: RRID:RGD_150520211 Copy   


  • RRID:RGD_150520212

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150520212

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2021-11-05)
Alternate IDs: 150520212
Notes: using CRISPR/Cas9, exon 8 of the pvt1 gene was deleted from the ACI genome. Resulting in a total excision of 588bp.

Proper citation: RRID:RGD_150520212 Copy   


  • RRID:RGD_150520213

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150520213

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2021-11-05)
Alternate IDs: 150520213
Notes: using CRISPR/Cas9, exon 8 of the pvt1 gene was deleted from the ACI genome. Resulting in a total excision of 588bp. This strain is maintained at Rat Resource and Research Center.

Proper citation: RRID:RGD_150520213 Copy   


  • RRID:RGD_150520214

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150520214

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2021-11-05)
Alternate IDs: 150520214
Notes: CRISPR/Cas9 was used to delete miR1208 in a 763bp excision in ACI rat embryos.

Proper citation: RRID:RGD_150520214 Copy   


  • RRID:RGD_126925756

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126925756

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126925756
Notes: This spontaneous mutation was identified in the offspring of pregnant Sprague-Dawley rats purchased from Taconic Farms. This mutant exhibited abnormal eye phenotype including nuclear cataracts and was called Nuc1 rat. Sequencing of the mutant allele revealed a 27 base pair insertion in exon 6 of Cryba1.

Proper citation: RRID:RGD_126925756 Copy   


  • RRID:RGD_150520205

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150520205

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150520205
Notes: This strain is derived from SHR/OlaIpcv where a spontaneous mutation was observed in the NH2-terminal cytosolic domain of Cx50, L7Q. The connexin50 mutation in heterozygous state affects significantly the lipid profile and the oxidative stress parameters in SHR rats.

Proper citation: RRID:RGD_150520205 Copy   


  • RRID:RGD_127285380

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=127285380

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 127285380
Notes: CRISPR/Cas9 system was used to introduce the gene knockout of Mir31 in the Sprague Dawley embryos.

Proper citation: RRID:RGD_127285380 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150520207

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-05)
Alternate IDs: 150520207
Notes: The CRISPR/Cas9 system was used to introduce 2 AttP landing sites in the ROSA26 locus of F344/NHsd rat embryos. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Rat Resource and Research Center (RRRC)

Proper citation: RRID:RGD_150520207 Copy   


  • RRID:RGD_150520208

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150520208

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2021-11-05)
Alternate IDs: 150520208
Notes: Using CRISPR/Cas9, exon 1b of the Pvt1 gene was excised from the ACI/SegHsd genome in a 1165bp deletion.

Proper citation: RRID:RGD_150520208 Copy   


  • RRID:RGD_150520209

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150520209

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150520209
Notes: The ACI-Pvt1em1Shul was created using CRISPR/Cas9 by Shull laboratory at UW madison. The exon 1b of the Pvt1 gene was excised from the ACI/SegHsd genome in a 1165bp deletion. This strain is now maintained at Rat Resource and Research Center.

Proper citation: RRID:RGD_150520209 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X