Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC1986 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037013 | Caenorhabditis elegans | Y54G2A.20(gk1060) IV. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1060) in Y54G2A.20, detectable by PCR using the following primers. External left primer: TCGCAATGAGTGTTCTCCTG. External right primer: CTCATTCCCTGAACTCTCGC. Internal left primer: GGACAGGCCGCATACATATT. Internal right primer: ATCTCAAGAACGTTCACCGC. Internal WT amplicon: 2280 bp. Deletion size: 751 bp. Deletion left flank: GCCCTTAGATGCCAGAGCGGAAATTTCCAT. Deletion right flank: ATGGTTGAGAACTGACGCTTTGGATGAATA. Validation: PCR diagnostic for gk1060 equivocal. No CGH probes for gk1060."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00021885(Y54G2A.20) | WBGene00021885(Y54G2A.20) | WB-STRAIN:WBStrain00037013 | WormBase (WB) | WB | available | WB-STRAIN:VC1986, CGC_VC1986 | WormBase | 2026-09-26 11:29:34 | 0 | |||
|
VC1995 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037019 | Caenorhabditis elegans | T12A2.15(ok2509) III. | T12A2.15. External left primer: ACTGGTTATCGAAATGCGGA. External right primer: ACAACAAATGTCGGACGTGA. Internal left primer: TCCTTATTTCCATCCAACGC. Internal right primer: ATGGTTGGTGGAGTCTCTGG. Internal WT amplicon: 3157 bp. Deletion size: 1090 bp. Deletion left flank: TTCTTGGGTTCGGGGTTTCTGATCGTTTTG. Deletion right flank: GATTTCCGCGTACGGATCTGATTTTCCCTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020443(esyt-2) | WBGene00020443(esyt-2) | WB-STRAIN:WBStrain00037019 | WormBase (WB) | WB | available | WB-STRAIN:VC1995, CGC_VC1995 | WormBase | 2026-09-26 11:29:34 | 0 | |||
|
VC1993 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037017 | Caenorhabditis elegans | nhr-288(gk1028) V. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y51A2B.3. External left primer: TTCCGCTGAAATGTTTTTCC. External right primer: TCATTGAATTGTTCCTGCCA. Internal left primer: TTCTCCATATTGCCCAGACC. Internal right primer: AAATACATCCACTGGGAGCG. Internal WT amplicon: 2180 bp. Deletion size: 699 bp. Deletion left flank: TTATTCGAATTTTCAATTTTCATATAATTA. Deletion right flank: GAAACCCATTTTCATAGAAATTCTCCCAAA." | WBGene00013067(nhr-288) | WBGene00013067(nhr-288) | WB-STRAIN:WBStrain00037017 | WormBase (WB) | WB | available | WB-STRAIN:VC1993, CGC_VC1993 | WormBase | 2026-09-26 11:29:34 | 0 | |||
|
VC1998 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037022 | Caenorhabditis elegans | C25H3.11(ok2632)/mIn1 [mIs14 dpy-10(e128)] II. | C25H3.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP o2632 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTGTTGAGCTTTGTTCCCA. External right primer: AAATCGATGAAAATTCCGCA. Internal left primer: AATCAACGCTCACTCGCTCT. Internal right primer: GGAATTCGAAAACCACGATG. Internal WT amplicon: 3051 bp. Deletion size: 1740 bp. Deletion left flank: CTCTCCTGGTTCCCATATTGTAGTTGGACG. Deletion right flank: ACTGTGTCATCTGATGCCTCGTCAATTCTA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00016120(vps-13D) | WBGene00001072(dpy-10), WBGene00016120(vps-13D) | WB-STRAIN:WBStrain00037022 | WormBase (WB) | WB | available | WB-STRAIN:VC1998, CGC_VC1998 | WormBase | 2026-09-26 11:29:34 | 0 | |||
|
VC1996 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037020 | Caenorhabditis elegans | T08B2.4(ok2534) I. | T08B2.4. External left primer: ATTTCAACAAGAACCGCTGG. External right primer: ACACGAGTTCATATTCCGGC. Internal left primer: ACGCGCATCAGTTACAAGAA. Internal right primer: AGCCTATATCTCCGTGCGAA. Internal WT amplicon: 1244 bp. Deletion size: 478 bp. Deletion left flank: GCCCTGGCAAGGCGATGTGGAGTTGAAGAT. Deletion right flank: TGTTTTTCTTCTACTTTTGAAATTGCTCCA. Insertion Sequence: T.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020345(T08B2.4) | WBGene00020345(T08B2.4) | WB-STRAIN:WBStrain00037020 | WormBase (WB) | WB | available | WB-STRAIN:VC1996, CGC_VC1996 | WormBase | 2026-09-26 11:29:34 | 0 | |||
|
VC2234 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037189 | Caenorhabditis elegans | sams-1(ok2947) X. | C49F5.1. External left primer: AGGACTTGCGAGAGTACGGA. External right primer: CTTGAGAGCTTTTGGCTGCT. Internal left primer: AGTGAATCTGTGTCCGAGGG. Internal right primer: GGGAACTCAGAGTGACCGAA. Internal WT amplicon: 1248 bp. Deletion size: 641 bp. Deletion left flank: TAGTTTATAGAATCTTGCTTTATTATTAGC. Deletion right flank: ATTGGTCAAGGCTGGACTTGCTAAGCGCGT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008205(sams-1) | WBGene00008205(sams-1) | WB-STRAIN:WBStrain00037189 | WormBase (WB) | WB | available | WB-STRAIN:VC2234, CGC_VC2234 | WormBase | 2026-09-26 11:29:37 | 0 | |||
|
VC2140 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037107 | Caenorhabditis elegans | ift-74(ok2866) II. | C18H9.8. External left primer: GATGCCTGTGTCAAGAGCTG. External right primer: CCACTTCAACCTTGCCAACT. Internal left primer: GGACCTCCAAGAGCACCTACT. Internal right primer: ACGCACAATTCCATGAAGAA. Internal WT amplicon: 1310 bp. Deletion size: 488 bp. Deletion left flank: ACATTTTCCAGACTCCCGTCAAGTATTTGA. Deletion right flank: AGCTTTTAAGAGAAAGAGTTGTAGAAATGG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016005(ift-74) | WBGene00016005(ift-74) | WB-STRAIN:WBStrain00037107 | WormBase (WB) | WB | available | PMID:38302462 | WB-STRAIN:VC2140, CGC_VC2140 | WormBase | 2026-09-26 11:29:36 | 0 | ||
|
VC2138 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037105 | Caenorhabditis elegans | kcnl-2(ok2818) I. | F08A10.1. External left primer: TTTCACAACTACCGCCCTTC. External right primer: AAAAAGAAGCGAACGAACGA. Internal left primer: GATGATTGGATGGTTGCCTT. Internal right primer: CCGACGTGATGATTACGCTA. Internal WT amplicon: 1193 bp. Deletion size: 546 bp. Deletion left flank: CTTCCAATCGAGTTCATAGCTCCATTTATG. Deletion right flank: AATTTCATGCAAGACACTCAACTTACTAAG. Insertion Sequence: TTTTCAT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008570(kcnl-2) | WBGene00008570(kcnl-2) | WB-STRAIN:WBStrain00037105 | WormBase (WB) | WB | available | WB-STRAIN:VC2138, CGC_VC2138 | WormBase | 2026-09-26 11:29:36 | 0 | |||
|
VC2240 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037194 | Caenorhabditis elegans | acs-4(ok2872) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | F37C12.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2872 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTTTCAGGCAAATTGGGT. External right primer: TTCCTGTGCTCAAGTCGTTG. Internal left primer: ATGTTTGGGAACTCGACAGC. Internal right primer: ATCCTTGAACAACAGGGCAG. Internal WT amplicon: 1170 bp. Deletion size: 335 bp. Deletion left flank: CTGAAGACCCTGATTTATTTCGCTCCTGTG. Deletion right flank: AATTTTTATTGGATTTAAAACTCATTTTAC. Insertion Sequence: CGAAATA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00018152(acs-4) | WBGene00000254(bli-4), WBGene00018152(acs-4) | WB-STRAIN:WBStrain00037194 | WormBase (WB) | WB | available | PMID:37164154 | WB-STRAIN:VC2240, CGC_VC2240 | WormBase | 2026-09-26 11:29:37 | 2 | ||
|
VC2238 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037192 | Caenorhabditis elegans | B0205.6(ok2890) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | B0205.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2890 homozygotes (sterile unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGAACAAAACCAGCAAT. External right primer: CCTGTCCTCCACCAGACATT. Internal left primer: CTCGAGTAGTCGACGCAATG. Internal right primer: GCTTCAATACGAACACGTGGA. Internal WT amplicon: 1094 bp. Deletion size: 255 bp. Deletion left flank: ACTGAATCAAATAATTTGGCGATTAAAGGA. Deletion right flank: ATATTTGGAAAATGAAGGATTTAAAGTGAC. Insertion Sequence: TTTTGGAAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00015021(nfs-1) | WBGene00000254(bli-4), WBGene00015021(nfs-1) | WB-STRAIN:WBStrain00037192 | WormBase (WB) | WB | available | WB-STRAIN:VC2238, CGC_VC2238 | WormBase | 2026-09-26 11:29:37 | 0 | |||
|
VC2143 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037110 | Caenorhabditis elegans | F54D5.3(ok2891) II. | F54D5.3. External left primer: TTGGCTTTGCAGGAGCTAAT. External right primer: CAAAATGCAGCGAAAAACAA. Internal left primer: CACCGATGACACTGGTCACT. Internal right primer: CAATTTGGCCGGAGATTTTA. Internal WT amplicon: 1165 bp. Deletion size: 455 bp. Deletion left flank: CTATTTAATAAGCTTCGTTACCAACTTCTG. Deletion right flank: CAAGGTTCGAATTGGATTTTTTTTAACTAA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010049(F54D5.3) | WBGene00010049(F54D5.3) | WB-STRAIN:WBStrain00037110 | WormBase (WB) | WB | available | WB-STRAIN:VC2143, CGC_VC2143 | WormBase | 2026-09-26 11:29:36 | 0 | |||
|
VC2244 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037197 | Caenorhabditis elegans | F59C6.2(gk981) I. | F59C.2. External left primer: AATGAGCTTGTTTGGATGGG. External right primer: GCTTCGAGGAAGAAACGAGA. Internal left primer: GCACAACCAGAGAGAAAGGC. Internal right primer: CCATCTCACCAAGCCCTAAC. Internal WT amplicon: 1657 bp. Deletion size: 605 bp. Deletion left flank: CGTTTTGTGCTCCTTATCTACATTTACTAC. Deletion right flank: GCTGGCCTCCATATTGTTTTAATAGATATT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010323(dhhc-12) | WBGene00010323(dhhc-12) | WB-STRAIN:WBStrain00037197 | WormBase (WB) | WB | available | WB-STRAIN:VC2244, CGC_VC2244 | WormBase | 2026-09-26 11:29:37 | 0 | |||
|
VC2149 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037114 | Caenorhabditis elegans | T12G3.1(ok2869) IV. | Made_by: Vancouver KO Group|"T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 406 bp. Deletion left flank: CCACTCCAGTTCCATTCCCTCCATCTCCAA. Deletion right flank: GAAATCTGCCGAGAGACTATTCACAATGCA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011737(sqst-1) | WBGene00011737(sqst-1) | WB-STRAIN:WBStrain00037114 | WormBase (WB) | WB | available | WB-STRAIN:VC2149, CGC_VC2149 | WormBase | 2026-09-26 11:29:36 | 0 | |||
|
VC2150 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037115 | Caenorhabditis elegans | C06B8.7(ok2814) V/nT1 [qIs51] (IV;V). | C06B8.7. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2814 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 680 bp. Deletion left flank: GCTTAAAGCAGGAGAGACCAAAGCGTGCTT. Deletion right flank: TCTCCGAATGATCGTATCACACTGGCCAAC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00007372(C06B8.7) | WBGene00007372(C06B8.7) | WB-STRAIN:WBStrain00037115 | WormBase (WB) | WB | available | WB-STRAIN:VC2150, CGC_VC2150 | WormBase | 2026-09-26 11:29:36 | 0 | |||
|
VC2148 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037113 | Caenorhabditis elegans | F23B12.4(ok2848) V/nT1 [qIs51] (IV;V). | F23B12.4. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2848 homozygotes (Dpy hermaphrodite, strongly Him, males more WT. Healthy gravid WT non-GFP segregants are recombinants and not true homozygotes). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCGCATTTGAAAGTATGA. External right primer: AAGCAAAAAGCAATGCAGGT. Internal left primer: GCAGTTGAACATCAGGGAGG. Internal right primer: GGACGCCTACGCACAATACT. Internal WT amplicon: 1145 bp. Deletion size: 396 bp. Deletion left flank: TACTACTTGAAAATGCTTCGTTAAAAATGA. Deletion right flank: GGAACTTCTAACAACAATTATATTCGACTG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00009081(F23B12.4) | WBGene00009081(F23B12.4) | WB-STRAIN:WBStrain00037113 | WormBase (WB) | WB | available | WB-STRAIN:VC2148, CGC_VC2148 | WormBase | 2026-09-26 11:29:36 | 0 | |||
|
VC2154 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037118 | Caenorhabditis elegans | F16B12.5(gk1009) X. | F16B12.5. External left primer: AATTGTACGGCGGAAAACTG. External right primer: ACCACGGTTGCATAGGACTC. Internal left primer: CTTGGCAAGACAAATGATCG. Internal right primer: CTGGACGGGTCAGTTTCAAT. Internal WT amplicon: 2766 bp. Deletion size: 1271 bp. Deletion left flank: GCATTTGGTCTCAATGAAAAAAAGAATCAG. Deletion right flank: TTAATTAGTACCACATTTAGGATGCAAAAA. Insertion Sequence: AAAAAGAAAACA.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008881(F16B12.5) | WBGene00008881(F16B12.5) | WB-STRAIN:WBStrain00037118 | WormBase (WB) | WB | available | WB-STRAIN:VC2154, CGC_VC2154 | WormBase | 2026-09-26 11:29:36 | 0 | |||
|
VC2155 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037119 | Caenorhabditis elegans | K09H9.7(gk1080) I. | K09H9.7. External left primer: TTGTGGAAACGGCTTAGACC. External right primer: AAACATTTCGAATTACGCCG. Internal left primer: GCGGTGAATCAGGAGATGAT. Internal right primer: TTTCAGGAAACCAGCGATTC. Internal WT amplicon: 1078 bp. Deletion size: 246 bp. Deletion left flank: TTCTTCGTCTGCGGTGAATCAGGAGATGAT. Deletion right flank: ACCTTAATATATCAATTAATAAAGGTATAG.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00019598(K09H9.7) | WBGene00019598(K09H9.7) | WB-STRAIN:WBStrain00037119 | WormBase (WB) | WB | available | WB-STRAIN:VC2155, CGC_VC2155 | WormBase | 2026-09-26 11:29:36 | 0 | |||
|
VC2151 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037116 | Caenorhabditis elegans | E02H1.5&E02H1.6(ok2819)/mIn1 [mIs14 dpy-10(e128)] II. | E02H1.5, E02H1.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2819 homozygotes (late larval arrest or sterile with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGACGTCGGTTTATGCAGC. External right primer: CCATGGTGTGCTCATTTTTG. Internal left primer: CCGGCATTCAAGTCAAATCT. Internal right primer: GGCAAGTTCGCAGATTCTTT. Internal WT amplicon: 2609 bp. Deletion size: 1622 bp. Deletion left flank: ACAATAATTAACCAAATTCCAGACGATAAT. Deletion right flank: CATTTCAGATCGTTTGGACAGTGATGAAGG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00008457(E02H1.5)|WBGene00008458(E02H1.6) | WBGene00001072(dpy-10), WBGene00008457(E02H1.5), WBGene00008458(E02H1.6) | WB-STRAIN:WBStrain00037116 | WormBase (WB) | WB | available | WB-STRAIN:VC2151, CGC_VC2151 | WormBase | 2026-09-26 11:29:36 | 0 | |||
|
VC2157 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037121 | Caenorhabditis elegans | his-37(gk1002) V. | C50F4.7. External left primer: GATCCAGAGCTTCTCGCAGT. External right primer: ACAATTCCAGGTGGACAAGC. Internal left primer: TCTTCACCGTCTTTCCGAAC. Internal right primer: ATGGTTGGTAGCCACTGCTT. Internal WT amplicon: 820 bp. Deletion size: 317 bp. Deletion left flank: TCGTTTTCTAACAACTTTTAATCATGTCTG. Deletion right flank: CGATGGACGTTGTCTATGCCTTGAAACGTC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001911(his-37) | WBGene00001911(his-37) | WB-STRAIN:WBStrain00037121 | WormBase (WB) | WB | available | WB-STRAIN:VC2157, CGC_VC2157 | WormBase | 2026-09-26 11:29:36 | 0 | |||
|
VC2158 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037122 | Caenorhabditis elegans | ifta-1(gk1004) X. | C54G7,4. External left primer: ACAATCGGAAAATTGCCAAG. External right primer: TAGATTACGCGGAGCGAAGT. Internal left primer: TTCCATATCGTGACACAGCG. Internal right primer: CCACGCCCTCAGTAAGGTAA. Internal WT amplicon: 2412 bp. Deletion size: 679 bp. Deletion left flank: TGATTTGCATCAGCGATGAATTGTGCTTTC. Deletion right flank: CACACTCAAAACCTTTCAGTACTTCATTAG. Insertion Sequence: GTGTGACCAAGCTGTTGAATGCTATTTAAGACGGAGCCTGCCACAGAAAGCATTGCACG CGTGTAAAGAGCTGAATCAGTGG.|"C54G7,4. External left primer: ACAATCGGAAAATTGCCAAG. External right primer: TAGATTACGCGGAGCGAAGT. Internal left primer: TTCCATATCGTGACACAGCG. Internal right primer: CCACGCCCTCAGTAAGGTAA. Internal WT amplicon: 2412 bp. Deletion size: 679 bp. Deletion left flank: TGATTTGCATCAGCGATGAATTGTGCTTTC. Deletion right flank: CACACTCAAAACCTTTCAGTACTTCATTAG. Insertion Sequence: GTGTGACCAAGCTGTTGAATGCTATTTAAGACGGAGCCTGCCACAGAAAGCATTGCACGCGTGTAAAGAGCTGAATCAGTGG."|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016935(ifta-1) | WBGene00016935(ifta-1) | WB-STRAIN:WBStrain00037122 | WormBase (WB) | WB | available | WB-STRAIN:VC2158, CGC_VC2158 | WormBase | 2026-09-26 11:29:36 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.