Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Authority Record Last Update Mentions Count
VC1986
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037013 Caenorhabditis elegans Y54G2A.20(gk1060) IV. Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1060) in Y54G2A.20, detectable by PCR using the following primers. External left primer: TCGCAATGAGTGTTCTCCTG. External right primer: CTCATTCCCTGAACTCTCGC. Internal left primer: GGACAGGCCGCATACATATT. Internal right primer: ATCTCAAGAACGTTCACCGC. Internal WT amplicon: 2280 bp. Deletion size: 751 bp. Deletion left flank: GCCCTTAGATGCCAGAGCGGAAATTTCCAT. Deletion right flank: ATGGTTGAGAACTGACGCTTTGGATGAATA. Validation: PCR diagnostic for gk1060 equivocal. No CGH probes for gk1060."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00021885(Y54G2A.20) WBGene00021885(Y54G2A.20) WB-STRAIN:WBStrain00037013 WormBase (WB) WB available WB-STRAIN:VC1986, CGC_VC1986 WormBase 2026-09-26 11:29:34 0
VC1995
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037019 Caenorhabditis elegans T12A2.15(ok2509) III. T12A2.15. External left primer: ACTGGTTATCGAAATGCGGA. External right primer: ACAACAAATGTCGGACGTGA. Internal left primer: TCCTTATTTCCATCCAACGC. Internal right primer: ATGGTTGGTGGAGTCTCTGG. Internal WT amplicon: 3157 bp. Deletion size: 1090 bp. Deletion left flank: TTCTTGGGTTCGGGGTTTCTGATCGTTTTG. Deletion right flank: GATTTCCGCGTACGGATCTGATTTTCCCTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00020443(esyt-2) WBGene00020443(esyt-2) WB-STRAIN:WBStrain00037019 WormBase (WB) WB available WB-STRAIN:VC1995, CGC_VC1995 WormBase 2026-09-26 11:29:34 0
VC1993
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037017 Caenorhabditis elegans nhr-288(gk1028) V. Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y51A2B.3. External left primer: TTCCGCTGAAATGTTTTTCC. External right primer: TCATTGAATTGTTCCTGCCA. Internal left primer: TTCTCCATATTGCCCAGACC. Internal right primer: AAATACATCCACTGGGAGCG. Internal WT amplicon: 2180 bp. Deletion size: 699 bp. Deletion left flank: TTATTCGAATTTTCAATTTTCATATAATTA. Deletion right flank: GAAACCCATTTTCATAGAAATTCTCCCAAA." WBGene00013067(nhr-288) WBGene00013067(nhr-288) WB-STRAIN:WBStrain00037017 WormBase (WB) WB available WB-STRAIN:VC1993, CGC_VC1993 WormBase 2026-09-26 11:29:34 0
VC1998
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037022 Caenorhabditis elegans C25H3.11(ok2632)/mIn1 [mIs14 dpy-10(e128)] II. C25H3.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP o2632 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTGTTGAGCTTTGTTCCCA. External right primer: AAATCGATGAAAATTCCGCA. Internal left primer: AATCAACGCTCACTCGCTCT. Internal right primer: GGAATTCGAAAACCACGATG. Internal WT amplicon: 3051 bp. Deletion size: 1740 bp. Deletion left flank: CTCTCCTGGTTCCCATATTGTAGTTGGACG. Deletion right flank: ACTGTGTCATCTGATGCCTCGTCAATTCTA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00001072(dpy-10)|WBGene00016120(vps-13D) WBGene00001072(dpy-10), WBGene00016120(vps-13D) WB-STRAIN:WBStrain00037022 WormBase (WB) WB available WB-STRAIN:VC1998, CGC_VC1998 WormBase 2026-09-26 11:29:34 0
VC1996
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037020 Caenorhabditis elegans T08B2.4(ok2534) I. T08B2.4. External left primer: ATTTCAACAAGAACCGCTGG. External right primer: ACACGAGTTCATATTCCGGC. Internal left primer: ACGCGCATCAGTTACAAGAA. Internal right primer: AGCCTATATCTCCGTGCGAA. Internal WT amplicon: 1244 bp. Deletion size: 478 bp. Deletion left flank: GCCCTGGCAAGGCGATGTGGAGTTGAAGAT. Deletion right flank: TGTTTTTCTTCTACTTTTGAAATTGCTCCA. Insertion Sequence: T.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00020345(T08B2.4) WBGene00020345(T08B2.4) WB-STRAIN:WBStrain00037020 WormBase (WB) WB available WB-STRAIN:VC1996, CGC_VC1996 WormBase 2026-09-26 11:29:34 0
VC2234
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037189 Caenorhabditis elegans sams-1(ok2947) X. C49F5.1. External left primer: AGGACTTGCGAGAGTACGGA. External right primer: CTTGAGAGCTTTTGGCTGCT. Internal left primer: AGTGAATCTGTGTCCGAGGG. Internal right primer: GGGAACTCAGAGTGACCGAA. Internal WT amplicon: 1248 bp. Deletion size: 641 bp. Deletion left flank: TAGTTTATAGAATCTTGCTTTATTATTAGC. Deletion right flank: ATTGGTCAAGGCTGGACTTGCTAAGCGCGT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00008205(sams-1) WBGene00008205(sams-1) WB-STRAIN:WBStrain00037189 WormBase (WB) WB available WB-STRAIN:VC2234, CGC_VC2234 WormBase 2026-09-26 11:29:37 0
VC2140
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037107 Caenorhabditis elegans ift-74(ok2866) II. C18H9.8. External left primer: GATGCCTGTGTCAAGAGCTG. External right primer: CCACTTCAACCTTGCCAACT. Internal left primer: GGACCTCCAAGAGCACCTACT. Internal right primer: ACGCACAATTCCATGAAGAA. Internal WT amplicon: 1310 bp. Deletion size: 488 bp. Deletion left flank: ACATTTTCCAGACTCCCGTCAAGTATTTGA. Deletion right flank: AGCTTTTAAGAGAAAGAGTTGTAGAAATGG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00016005(ift-74) WBGene00016005(ift-74) WB-STRAIN:WBStrain00037107 WormBase (WB) WB available PMID:38302462 WB-STRAIN:VC2140, CGC_VC2140 WormBase 2026-09-26 11:29:36 0
VC2138
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037105 Caenorhabditis elegans kcnl-2(ok2818) I. F08A10.1. External left primer: TTTCACAACTACCGCCCTTC. External right primer: AAAAAGAAGCGAACGAACGA. Internal left primer: GATGATTGGATGGTTGCCTT. Internal right primer: CCGACGTGATGATTACGCTA. Internal WT amplicon: 1193 bp. Deletion size: 546 bp. Deletion left flank: CTTCCAATCGAGTTCATAGCTCCATTTATG. Deletion right flank: AATTTCATGCAAGACACTCAACTTACTAAG. Insertion Sequence: TTTTCAT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00008570(kcnl-2) WBGene00008570(kcnl-2) WB-STRAIN:WBStrain00037105 WormBase (WB) WB available WB-STRAIN:VC2138, CGC_VC2138 WormBase 2026-09-26 11:29:36 0
VC2240
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00037194 Caenorhabditis elegans acs-4(ok2872) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). F37C12.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2872 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTTTCAGGCAAATTGGGT. External right primer: TTCCTGTGCTCAAGTCGTTG. Internal left primer: ATGTTTGGGAACTCGACAGC. Internal right primer: ATCCTTGAACAACAGGGCAG. Internal WT amplicon: 1170 bp. Deletion size: 335 bp. Deletion left flank: CTGAAGACCCTGATTTATTTCGCTCCTGTG. Deletion right flank: AATTTTTATTGGATTTAAAACTCATTTTAC. Insertion Sequence: CGAAATA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000254(bli-4)|WBGene00018152(acs-4) WBGene00000254(bli-4), WBGene00018152(acs-4) WB-STRAIN:WBStrain00037194 WormBase (WB) WB available PMID:37164154 WB-STRAIN:VC2240, CGC_VC2240 WormBase 2026-09-26 11:29:37 2
VC2238
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037192 Caenorhabditis elegans B0205.6(ok2890) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). B0205.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2890 homozygotes (sterile unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGAACAAAACCAGCAAT. External right primer: CCTGTCCTCCACCAGACATT. Internal left primer: CTCGAGTAGTCGACGCAATG. Internal right primer: GCTTCAATACGAACACGTGGA. Internal WT amplicon: 1094 bp. Deletion size: 255 bp. Deletion left flank: ACTGAATCAAATAATTTGGCGATTAAAGGA. Deletion right flank: ATATTTGGAAAATGAAGGATTTAAAGTGAC. Insertion Sequence: TTTTGGAAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000254(bli-4)|WBGene00015021(nfs-1) WBGene00000254(bli-4), WBGene00015021(nfs-1) WB-STRAIN:WBStrain00037192 WormBase (WB) WB available WB-STRAIN:VC2238, CGC_VC2238 WormBase 2026-09-26 11:29:37 0
VC2143
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037110 Caenorhabditis elegans F54D5.3(ok2891) II. F54D5.3. External left primer: TTGGCTTTGCAGGAGCTAAT. External right primer: CAAAATGCAGCGAAAAACAA. Internal left primer: CACCGATGACACTGGTCACT. Internal right primer: CAATTTGGCCGGAGATTTTA. Internal WT amplicon: 1165 bp. Deletion size: 455 bp. Deletion left flank: CTATTTAATAAGCTTCGTTACCAACTTCTG. Deletion right flank: CAAGGTTCGAATTGGATTTTTTTTAACTAA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00010049(F54D5.3) WBGene00010049(F54D5.3) WB-STRAIN:WBStrain00037110 WormBase (WB) WB available WB-STRAIN:VC2143, CGC_VC2143 WormBase 2026-09-26 11:29:36 0
VC2244
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037197 Caenorhabditis elegans F59C6.2(gk981) I. F59C.2. External left primer: AATGAGCTTGTTTGGATGGG. External right primer: GCTTCGAGGAAGAAACGAGA. Internal left primer: GCACAACCAGAGAGAAAGGC. Internal right primer: CCATCTCACCAAGCCCTAAC. Internal WT amplicon: 1657 bp. Deletion size: 605 bp. Deletion left flank: CGTTTTGTGCTCCTTATCTACATTTACTAC. Deletion right flank: GCTGGCCTCCATATTGTTTTAATAGATATT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00010323(dhhc-12) WBGene00010323(dhhc-12) WB-STRAIN:WBStrain00037197 WormBase (WB) WB available WB-STRAIN:VC2244, CGC_VC2244 WormBase 2026-09-26 11:29:37 0
VC2149
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037114 Caenorhabditis elegans T12G3.1(ok2869) IV. Made_by: Vancouver KO Group|"T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 406 bp. Deletion left flank: CCACTCCAGTTCCATTCCCTCCATCTCCAA. Deletion right flank: GAAATCTGCCGAGAGACTATTCACAATGCA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00011737(sqst-1) WBGene00011737(sqst-1) WB-STRAIN:WBStrain00037114 WormBase (WB) WB available WB-STRAIN:VC2149, CGC_VC2149 WormBase 2026-09-26 11:29:36 0
VC2150
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037115 Caenorhabditis elegans C06B8.7(ok2814) V/nT1 [qIs51] (IV;V). C06B8.7. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2814 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 680 bp. Deletion left flank: GCTTAAAGCAGGAGAGACCAAAGCGTGCTT. Deletion right flank: TCTCCGAATGATCGTATCACACTGGCCAAC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00007372(C06B8.7) WBGene00007372(C06B8.7) WB-STRAIN:WBStrain00037115 WormBase (WB) WB available WB-STRAIN:VC2150, CGC_VC2150 WormBase 2026-09-26 11:29:36 0
VC2148
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037113 Caenorhabditis elegans F23B12.4(ok2848) V/nT1 [qIs51] (IV;V). F23B12.4. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2848 homozygotes (Dpy hermaphrodite, strongly Him, males more WT. Healthy gravid WT non-GFP segregants are recombinants and not true homozygotes). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCGCATTTGAAAGTATGA. External right primer: AAGCAAAAAGCAATGCAGGT. Internal left primer: GCAGTTGAACATCAGGGAGG. Internal right primer: GGACGCCTACGCACAATACT. Internal WT amplicon: 1145 bp. Deletion size: 396 bp. Deletion left flank: TACTACTTGAAAATGCTTCGTTAAAAATGA. Deletion right flank: GGAACTTCTAACAACAATTATATTCGACTG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00009081(F23B12.4) WBGene00009081(F23B12.4) WB-STRAIN:WBStrain00037113 WormBase (WB) WB available WB-STRAIN:VC2148, CGC_VC2148 WormBase 2026-09-26 11:29:36 0
VC2154
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037118 Caenorhabditis elegans F16B12.5(gk1009) X. F16B12.5. External left primer: AATTGTACGGCGGAAAACTG. External right primer: ACCACGGTTGCATAGGACTC. Internal left primer: CTTGGCAAGACAAATGATCG. Internal right primer: CTGGACGGGTCAGTTTCAAT. Internal WT amplicon: 2766 bp. Deletion size: 1271 bp. Deletion left flank: GCATTTGGTCTCAATGAAAAAAAGAATCAG. Deletion right flank: TTAATTAGTACCACATTTAGGATGCAAAAA. Insertion Sequence: AAAAAGAAAACA.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00008881(F16B12.5) WBGene00008881(F16B12.5) WB-STRAIN:WBStrain00037118 WormBase (WB) WB available WB-STRAIN:VC2154, CGC_VC2154 WormBase 2026-09-26 11:29:36 0
VC2155
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037119 Caenorhabditis elegans K09H9.7(gk1080) I. K09H9.7. External left primer: TTGTGGAAACGGCTTAGACC. External right primer: AAACATTTCGAATTACGCCG. Internal left primer: GCGGTGAATCAGGAGATGAT. Internal right primer: TTTCAGGAAACCAGCGATTC. Internal WT amplicon: 1078 bp. Deletion size: 246 bp. Deletion left flank: TTCTTCGTCTGCGGTGAATCAGGAGATGAT. Deletion right flank: ACCTTAATATATCAATTAATAAAGGTATAG.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00019598(K09H9.7) WBGene00019598(K09H9.7) WB-STRAIN:WBStrain00037119 WormBase (WB) WB available WB-STRAIN:VC2155, CGC_VC2155 WormBase 2026-09-26 11:29:36 0
VC2151
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037116 Caenorhabditis elegans E02H1.5&E02H1.6(ok2819)/mIn1 [mIs14 dpy-10(e128)] II. E02H1.5, E02H1.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2819 homozygotes (late larval arrest or sterile with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGACGTCGGTTTATGCAGC. External right primer: CCATGGTGTGCTCATTTTTG. Internal left primer: CCGGCATTCAAGTCAAATCT. Internal right primer: GGCAAGTTCGCAGATTCTTT. Internal WT amplicon: 2609 bp. Deletion size: 1622 bp. Deletion left flank: ACAATAATTAACCAAATTCCAGACGATAAT. Deletion right flank: CATTTCAGATCGTTTGGACAGTGATGAAGG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00001072(dpy-10)|WBGene00008457(E02H1.5)|WBGene00008458(E02H1.6) WBGene00001072(dpy-10), WBGene00008457(E02H1.5), WBGene00008458(E02H1.6) WB-STRAIN:WBStrain00037116 WormBase (WB) WB available WB-STRAIN:VC2151, CGC_VC2151 WormBase 2026-09-26 11:29:36 0
VC2157
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037121 Caenorhabditis elegans his-37(gk1002) V. C50F4.7. External left primer: GATCCAGAGCTTCTCGCAGT. External right primer: ACAATTCCAGGTGGACAAGC. Internal left primer: TCTTCACCGTCTTTCCGAAC. Internal right primer: ATGGTTGGTAGCCACTGCTT. Internal WT amplicon: 820 bp. Deletion size: 317 bp. Deletion left flank: TCGTTTTCTAACAACTTTTAATCATGTCTG. Deletion right flank: CGATGGACGTTGTCTATGCCTTGAAACGTC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00001911(his-37) WBGene00001911(his-37) WB-STRAIN:WBStrain00037121 WormBase (WB) WB available WB-STRAIN:VC2157, CGC_VC2157 WormBase 2026-09-26 11:29:36 0
VC2158
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037122 Caenorhabditis elegans ifta-1(gk1004) X. C54G7,4. External left primer: ACAATCGGAAAATTGCCAAG. External right primer: TAGATTACGCGGAGCGAAGT. Internal left primer: TTCCATATCGTGACACAGCG. Internal right primer: CCACGCCCTCAGTAAGGTAA. Internal WT amplicon: 2412 bp. Deletion size: 679 bp. Deletion left flank: TGATTTGCATCAGCGATGAATTGTGCTTTC. Deletion right flank: CACACTCAAAACCTTTCAGTACTTCATTAG. Insertion Sequence: GTGTGACCAAGCTGTTGAATGCTATTTAAGACGGAGCCTGCCACAGAAAGCATTGCACG CGTGTAAAGAGCTGAATCAGTGG.|"C54G7,4. External left primer: ACAATCGGAAAATTGCCAAG. External right primer: TAGATTACGCGGAGCGAAGT. Internal left primer: TTCCATATCGTGACACAGCG. Internal right primer: CCACGCCCTCAGTAAGGTAA. Internal WT amplicon: 2412 bp. Deletion size: 679 bp. Deletion left flank: TGATTTGCATCAGCGATGAATTGTGCTTTC. Deletion right flank: CACACTCAAAACCTTTCAGTACTTCATTAG. Insertion Sequence: GTGTGACCAAGCTGTTGAATGCTATTTAAGACGGAGCCTGCCACAGAAAGCATTGCACGCGTGTAAAGAGCTGAATCAGTGG."|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00016935(ifta-1) WBGene00016935(ifta-1) WB-STRAIN:WBStrain00037122 WormBase (WB) WB available WB-STRAIN:VC2158, CGC_VC2158 WormBase 2026-09-26 11:29:36 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.