Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 17 showing 321 ~ 340 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00037156

http://www.wormbase.org/db/get?name=WBStrain00037156

Source Database: WormBase (WB)
Affected Genes: WBGene00007307(spch-1)
Genomic Alteration: WBGene00007307(spch-1)
Availability: available
Synonyms: C04G2.8(ok2887) IV.
Alternate IDs: WB-STRAIN:VC2195, CGC_VC2195
Notes: C04G2.8. External left primer: TGTCCTGGGTAGGTTGGGTA. External right primer: ATCCCGAATCTGTCCAATCA. Internal left primer: GACCTTTTCACGAGGCAATC. Internal right primer: GGTCCTTCGACAACCATAGC. Internal WT amplicon: 1315 bp. Deletion size: 407 bp. Deletion left flank: ATTGAAAACGATTGGATAGAGAAGTCAGCG. Deletion right flank: AATAAGAGCGACTTCTGGAGCGGCTTCTGG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037156 Copy   


  • RRID:WB-STRAIN:WBStrain00037157

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037157

Source Database: WormBase (WB)
Affected Genes: WBGene00011737(sqst-1)
Genomic Alteration: WBGene00011737(sqst-1)
Availability: available
Synonyms: T12G3.1(ok2892) IV.
Alternate IDs: WB-STRAIN:VC2196, CGC_VC2196
Notes: Made_by: Vancouver KO Group|"T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 795 bp. Deletion left flank: ATCAGTGAGCACTGAAACTGCCAAAAAAGC. Deletion right flank: AATGACCAAATTCGAAGAGAAAATGGATAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037157 Copy   


  • RRID:WB-STRAIN:WBStrain00037162

http://www.wormbase.org/db/get?name=WBStrain00037162

Source Database: WormBase (WB)
Affected Genes: WBGene00011502(vps-53)
Genomic Alteration: WBGene00011502(vps-53)
Availability: available
Synonyms: T05G5.8(ok2864) III.
Alternate IDs: WB-STRAIN:VC2202, CGC_VC2202
Notes: Made_by: Vancouver KO Group|"T05G5.8. External left primer: AGAGCAGCATCACAAGTGGA. External right primer: CTGGAAAAGGGGGACAAAAT. Internal left primer: CAACATCCTGAACTAAAACCTGG. Internal right primer: TATGTGTAGAGTGGCGGCTG. Internal WT amplicon: 1123 bp. Deletion size: 373 bp. Deletion left flank: CCAGGAACTCATTTAAAGTTTTCTCTTGAG. Deletion right flank: TTGCTGTTCGATGAACCATTTTACAAAGTT. Insertion Sequence: TATTTATAAATACATCCAAGAAAGTATCAAAAACACTCCAAATAGCTTTTTCGAATGAA A."|"T05G5.8. External left primer: AGAGCAGCATCACAAGTGGA. External right primer: CTGGAAAAGGGGGACAAAAT. Internal left primer: CAACATCCTGAACTAAAACCTGG. Internal right primer: TATGTGTAGAGTGGCGGCTG. Internal WT amplicon: 1123 bp. Deletion size: 373 bp. Deletion left flank: CCAGGAACTCATTTAAAGTTTTCTCTTGAG. Deletion right flank: TTGCTGTTCGATGAACCATTTTACAAAGTT. Insertion Sequence: TATTTATAAATACATCCAAGAAAGTATCAAAAACACTCCAAATAGCTTTTTCGAATGAAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037162 Copy   


  • RRID:WB-STRAIN:WBStrain00037165

http://www.wormbase.org/db/get?name=WBStrain00037165

Source Database: WormBase (WB)
Affected Genes: WBGene00019087(citk-2)
Genomic Alteration: WBGene00019087(citk-2)
Availability: available
Synonyms: citk-2(ok2885) II.
Alternate IDs: WB-STRAIN:VC2205, CGC_VC2205
Notes: F59A6.5. External left primer: CAACAACGAATCACACGAGG. External right primer: CCACTTTGCGTTGACTCTCA. Internal left primer: TGGACGCTGAGAACATCATC. Internal right primer: GATTCGAACCACCATCTCGT. Internal WT amplicon: 1323 bp. Deletion size: 693 bp. Deletion left flank: CAAGAACGACATGAAAGAGAACGATCGCAA. Deletion right flank: AACATTTGATTATGGCCGACCAACAGTGTT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037165 Copy   


  • RRID:WB-STRAIN:WBStrain00037164

http://www.wormbase.org/db/get?name=WBStrain00037164

Source Database: WormBase (WB)
Affected Genes: WBGene00006845(unc-122)
Genomic Alteration: WBGene00006845(unc-122)
Availability: available
Synonyms: unc-122(ok2882) I.
Alternate IDs: WB-STRAIN:VC2204, CGC_VC2204
Notes: F11C3.2. External left primer: CCCATTCACATTTTCAGGCT. External right primer: TGCCGCACACCAATAATAAA. Internal left primer: CCGGCGAAATAGGAAATGTA. Internal right primer: ACTTCCTGCGGAAGAAACCT. Internal WT amplicon: 1145 bp. Deletion size: 327 bp. Deletion left flank: TGATCACAAAAATCAAGAACTCTCAGAGAA. Deletion right flank: GAAAAAATGGTTCCTGTGCCAGTAGTGGTT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037164 Copy   


  • RRID:WB-STRAIN:WBStrain00037125

http://www.wormbase.org/db/get?name=WBStrain00037125

Source Database: WormBase (WB)
Affected Genes: WBGene00001127(dyf-11)
Genomic Alteration: WBGene00001127(dyf-11)
Availability: available
Synonyms: dyf-11(ok2926) X.
Alternate IDs: WB-STRAIN:VC2161, CGC_VC2161
Notes: C02H7.1. External left primer: TTCAAGGAATGGTACCGGAG. External right primer: GGGCATTTCCAAGTTTTTCA. Internal left primer: GGAAACGCATGAAGAGAAGG. Internal right primer: CCTTGCTAGCGGATAAGCAG. Internal WT amplicon: 1196 bp. Deletion size: 647 bp. Deletion left flank: ACTGTTATATCAAATATGGAAACTGATTTG. Deletion right flank: AAGATTTAGTTGATGAAGAAGATAGAGGAG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037125 Copy   


  • RRID:WB-STRAIN:WBStrain00037126

http://www.wormbase.org/db/get?name=WBStrain00037126

Source Database: WormBase (WB)
Affected Genes: WBGene00013147(eyg-1)
Genomic Alteration: WBGene00013147(eyg-1)
Availability: available
Synonyms: Y53C12C.1(ok2201) II.
Alternate IDs: WB-STRAIN:VC2162, CGC_VC2162
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y53C12C.1. External left primer: GAACTTCGAAAATGGGCAAA. External right primer: TGATGCCGCCATATATTCAA. Internal left primer: ATCAATCAAGAATGCCCACC. Internal right primer: TTCACTCACGGTTTACCACG. Internal WT amplicon: 2128 bp. Deletion size: 1210 bp. Deletion left flank: AAAAAGTTTGAGTAGACTTTAACTGAGTAT. Deletion right flank: TTAATATAATTCAATTAATTCATCAGGTAA. Insertion Sequence: A."

Proper citation: RRID:WB-STRAIN:WBStrain00037126 Copy   


  • RRID:WB-STRAIN:WBStrain00037123

http://www.wormbase.org/db/get?name=WBStrain00037123

Source Database: WormBase (WB)
Affected Genes: WBGene00003998(pgp-4)
Genomic Alteration: WBGene00003998(pgp-4)
Availability: available
Synonyms: pgp-4(gk1006) X.
Alternate IDs: WB-STRAIN:VC2159, CGC_VC2159
Notes: F42E11.1. External left primer: TGGACTTGCATGGAACACAT. External right primer: AATCATTTCTTCACGGGCAC. Internal left primer: ACACTACAACTTACCCGCCG. Internal right primer: GGTGGTGTCATCTTTGGCTT. Internal WT amplicon: 2647 bp. Deletion size: 1230 bp. Deletion left flank: ACCACAAAATAATGTTTTCATTTTTAACTT. Deletion right flank: CTTATCCAACTAGACCTGACGTCAAAATTT. Insertion Sequence: TCAATTT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037123 Copy   


  • RRID:WB-STRAIN:WBStrain00037132

http://www.wormbase.org/db/get?name=WBStrain00037132

Source Database: WormBase (WB)
Affected Genes: WBGene00013969(tep-1)
Genomic Alteration: WBGene00013969(tep-1)
Availability: available
Synonyms: ZK337.1(ok2874) I.
Alternate IDs: WB-STRAIN:VC2168, CGC_VC2168
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK337.1. External left primer: TCCAGACGTGCTGACAACTC. External right primer: GGCGCTACTCCACCATTAAA. Internal left primer: TCAGCTTTTGGCGATAGTGAT. Internal right primer: GTCTTCCATGGCTGTGAGGT. Internal WT amplicon: 1142 bp. Deletion size: 360 bp. Deletion left flank: TCTCTCTCAATTATTCGTTGGTTAGTATCC. Deletion right flank: AAGTGGGCTTTTTTCAAATTTTTTCAAGTT."

Proper citation: RRID:WB-STRAIN:WBStrain00037132 Copy   


  • RRID:WB-STRAIN:WBStrain00037130

http://www.wormbase.org/db/get?name=WBStrain00037130

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00019401(nuo-4)
Genomic Alteration: WBGene00000254(bli-4), WBGene00019401(nuo-4)
Availability: available
Synonyms: nuo-4(ok2483) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2166, CGC_VC2166
Notes: K04G7.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2483 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACCCAAACGTGGCAATA. External right primer: TTGTTAAGACCATCATGCCG. Internal left primer: AAAAGTGTGCGTGGGGTAAT. Internal right primer: GTTCCATGAGCAAATTGGGA. Internal WT amplicon: 3154 bp. Deletion size: 1295 bp. Deletion left flank: TCTATTACTTAAAGCAAATTTTCAAATTGA. Deletion right flank: AGTCTAGAAACAATTATTTTGAAAGAAAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037130 Copy   


  • RRID:WB-STRAIN:WBStrain00037137

http://www.wormbase.org/db/get?name=WBStrain00037137

Source Database: WormBase (WB)
Affected Genes: WBGene00012629(slc-36.3)
Genomic Alteration: WBGene00012629(slc-36.3)
Availability: available
Synonyms: Y38H6C.17(ok2911) V.
Alternate IDs: WB-STRAIN:VC2174, CGC_VC2174
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y38H6C.17. External left primer: CCGGTTGCTTACATGCCTAC. External right primer: GATTCGCCAATCTTCCAAAA. Internal left primer: AAGCAATACGTACCGGTCTACA. Internal right primer: AAAGTTTCCAAATTTTTCGGC. Internal WT amplicon: 1372 bp. Deletion size: 525 bp. Deletion left flank: ATATACCCAAAGAATCCTAGAAATGCATAA. Deletion right flank: CGTTGCCGAAAAATTTGGAAACTTTCTATA."

Proper citation: RRID:WB-STRAIN:WBStrain00037137 Copy   


  • RRID:WB-STRAIN:WBStrain00037135

http://www.wormbase.org/db/get?name=WBStrain00037135

Source Database: WormBase (WB)
Affected Genes: WBGene00006576(tkr-1)
Genomic Alteration: WBGene00006576(tkr-1)
Availability: available
Synonyms: tkr-1(ok2886) III.
Alternate IDs: WB-STRAIN:VC2171, CGC_VC2171
Notes: C38C10.1. External left primer: TGGTCATGGTCGAATCCATA. External right primer: ACATTTTCCAATTCTTGCGG. Internal left primer: CTGCAATTGAATCGGAAACA. Internal right primer: TTTTGTTGCTCCGGATTTTC. Internal WT amplicon: 1214 bp. Deletion size: 755 bp. Deletion left flank: TACTATGACTGGTGGTATGGTGATCTATGT. Deletion right flank: ACTATCAAAAAATCAATGAAAATCCGGAGC. Insertion Sequence: GGTGATCTATGT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037135 Copy   


  • RRID:WB-STRAIN:WBStrain00037143

http://www.wormbase.org/db/get?name=WBStrain00037143

Source Database: WormBase (WB)
Affected Genes: WBGene00012473(Y17G7B.22)
Genomic Alteration: WBGene00012473(Y17G7B.22)
Availability: available
Synonyms: Y17G7B.22(gk1010) II.
Alternate IDs: WB-STRAIN:VC2180, CGC_VC2180
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y17G7B.22. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1350 bp. Deletion left flank: AATGGACCTGAAAGATTGAAAACAATTGAC. Deletion right flank: TTTTGGTGCTTCAAAAAACATCAAAAAATA. Insertion Sequence: GTGTGGTAAGCGAAAGTAAGCGAAAATTCAAGCTTCGATTGAATTATCATTTCAAAAAG AAATAAATGGAAAACGTATTGTAATCGCTGAACAAACTCCAAAAAATTTGATACTTTTT GATGTT."|"Y17G7B.22. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1350 bp. Deletion left flank: AATGGACCTGAAAGATTGAAAACAATTGAC. Deletion right flank: TTTTGGTGCTTCAAAAAACATCAAAAAATA. Insertion Sequence: GTGTGGTAAGCGAAAGTAAGCGAAAATTCAAGCTTCGATTGAATTATCATTTCAAAAAGAAATAAATGGAAAACGTATTGTAATCGCTGAACAAACTCCAAAAAATTTGATACTTTTTGATGTT."

Proper citation: RRID:WB-STRAIN:WBStrain00037143 Copy   


  • RRID:WB-STRAIN:WBStrain00037144

http://www.wormbase.org/db/get?name=WBStrain00037144

Source Database: WormBase (WB)
Affected Genes: WBGene00000108(alh-2)|WBGene00016918(test-1)
Genomic Alteration: WBGene00000108(alh-2), WBGene00016918(test-1)
Availability: available
Synonyms: C54E4.2(gk1083) IV; alh-2(gk3053) V.
Alternate IDs: WB-STRAIN:VC2181, CGC_VC2181
Notes: K04F1.15, C54E4.2. The allele gk1083 was identified by PCR, validated by CGH, and can be detected using the following PCR primers. External left primer: TTTTTGACGACCAACCAACA. External right primer: CGAGGCTCTTTACGCAATTC. Internal left primer: CGCAGCGAACAAAGTTATGA. Internal right primer: CGTGGCGAGACCTATAAAGC. Internal WT amplicon: 1288 bp. Deletion size: 575 bp. Deletion left flank: TGAATACCGTTAATTTTTTTTTTTTAATTA. Deletion right flank: TTCGCTGAAAAATATAATTTCTTTCTGGTG. The allele gk3053 was identified by CGH and not confirmed by PCR. Left flanking probe: ATTTTACATTAGTCCGTGAATTTCAGATACTACGCCGGATATGCTGATAA. Right flanking probe: GCGCGGGATCAGTTTGGGTCAACTGTTATGATGTTTTTGATCCTGCTGCT. Left deleted probe: TATGCTGATAAAAACCACGGAAAAACCATTCCCGTCGGTGGAGACTATTT. Right deleted probe: TGAATAAAGCTCTTCAAGTCGCAAATACTATCCGCGCGGGATCAGTTTGG.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037144 Copy   


  • RRID:WB-STRAIN:WBStrain00037142

http://www.wormbase.org/db/get?name=WBStrain00037142

Source Database: WormBase (WB)
Affected Genes: WBGene00020630(T20F7.1)
Genomic Alteration: WBGene00020630(T20F7.1)
Availability: available
Synonyms: T20F7.1(gk998) X.
Alternate IDs: WB-STRAIN:VC2179, CGC_VC2179
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T20F7.1. External left primer: AAACGACACTCCGTTTGGAC. External right primer: AGTGACCGGAAGCTCTTGAA. Internal left primer: TCCGGGAGAAGTATTCATGG. Internal right primer: CGGTCCTCCACATCTGAAAT. Internal WT amplicon: 2098 bp. Deletion size: 305 bp. Deletion left flank: ATTTTTTAAATGAGTTTGATATAAAAATGA. Deletion right flank: TATGAATCAACAGTATGGTGTGGAAAACCA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037142 Copy   


  • RRID:WB-STRAIN:WBStrain00037224

http://www.wormbase.org/db/get?name=WBStrain00037224

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00000381(cct-6)
Genomic Alteration: WBGene00000254(bli-4), WBGene00000381(cct-6)
Availability: available
Synonyms: cct-6(ok2904) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2279, CGC_VC2279
Notes: F01F1.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2904 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAGTTGGGCTTGTTGAACG. External right primer: CCCTCGAGTTGCTTGAAAAG. Internal left primer: ATTCTGGTTGTGGCTGCTTC. Internal right primer: GCGTGACCTCCTTGTAGAGG. Internal WT amplicon: 1286 bp. Deletion size: 605 bp. Deletion left flank: CCGAGCTTGGCACGTCCCTTCAGGTTCTCA. Deletion right flank: CTTCAGTCTTCTCGTATTCCAAAGAAACGT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037224 Copy   


  • RRID:WB-STRAIN:WBStrain00037225

http://www.wormbase.org/db/get?name=WBStrain00037225

Source Database: WormBase (WB)
Affected Genes: WBGene00001089(dre-1)
Genomic Alteration: WBGene00001089(dre-1)
Availability: available
Synonyms: dre-1(ok2905) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2280, CGC_VC2280
Notes: K04A8.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2905 homozygotes (early larval arrest; escapers may lay eggs that hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAGTAGGGATTCGCATGA. External right primer: CCCCTTTCAATTTCGAGTCA. Internal left primer: CAGCCAAAGTATTTCGAGCA. Internal right primer: CAGAAGGTCGAGGGAGACAT. Internal WT amplicon: 1211 bp. Deletion size: 741 bp. Deletion left flank: CTGCTGCCTGCACACTGGATCAGCCCGAAA. Deletion right flank: TTTTTTTCATTATTTCTTATCTCAAAAATG. Insertion Sequence: TCATTTTTTTATCTATCAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037225 Copy   


  • RRID:WB-STRAIN:WBStrain00037228

http://www.wormbase.org/db/get?name=WBStrain00037228

Source Database: WormBase (WB)
Affected Genes: WBGene00010329(pcdr-1)
Genomic Alteration: WBGene00010329(pcdr-1)
Availability: available
Synonyms: F59D12.1(gk1122) X.
Alternate IDs: WB-STRAIN:VC2285, CGC_VC2285
Notes: F59D12.1. Identified by PCR, validated by CGH. External left primer: CTCACAAAAAGGGGCGAATA. External right primer: TACCCCTTACACTAACGGCG. Internal left primer: GGTTGTGTTCTATCCCGACG. Internal right primer: ATGAGTGCTTGGGACTTTGG. Internal WT amplicon: 937 bp. Deletion size: 585 bp. Deletion left flank: ACTAGGTTTTCTGTTTGTCACATTTTTCTT. Deletion right flank: CTTATTTGAATATAAACATTCAAGATTTCT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037228 Copy   


  • RRID:WB-STRAIN:WBStrain00037229

http://www.wormbase.org/db/get?name=WBStrain00037229

Source Database: WormBase (WB)
Affected Genes: WBGene00002179(jph-1)
Genomic Alteration: WBGene00002179(jph-1)
Availability: available
Source References: PMID:39381635
Synonyms: jph-1(ok2823) I.
Alternate IDs: WB-STRAIN:VC2286, CGC_VC2286
Notes: T22C1.7. External left primer: TGGAATGTGTGGTTGAAGGA. External right primer: GGTGATCCCTCTGGCTGTAA. Internal left primer: TTGTGAATTGATTGGTGTTTGA. Internal right primer: GGCCTTTCTGGTAGAGGAGG. Internal WT amplicon: 1144 bp. Deletion size: 637 bp. Deletion left flank: TTCGGCATCACATGATTGTGATACGCTTTT. Deletion right flank: AATTTCAAAAATTTCCCTCATAATTTCAAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037229 Copy   


  • RRID:WB-STRAIN:WBStrain00037226

http://www.wormbase.org/db/get?name=WBStrain00037226

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00011631(tgs-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00011631(tgs-1)
Availability: available
Synonyms: T08G11.4(ok2909) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2281, CGC_VC2281
Notes: T08G11.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2909 homozygotes (early to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGATTTCCATGCGACTTTTT. External right primer: GAAATTTGTCGCAAATCGGT. Internal left primer: CTCGACGAGCTGAAAAATGT. Internal right primer: ACGGAGTCGCTTCTTTTCTG. Internal WT amplicon: 1281 bp. Deletion size: 505 bp. Deletion left flank: CAAATGAGACTAATGATGTTCTAAGTATAT. Deletion right flank: CAGTGAATGCATCGACAACAACAGAAACAT. Insertion Sequence: AT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037226 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X