Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SS-Kcnj2em2Mcwi Resource Report Resource Website |
RRID:RGD_14394494 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 28-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at [email protected] | 14394494 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2019-03-22) | 14394494 | RGD | 2026-09-26 02:42:12 | 0 | |||||
|
LE-Cyfip1em1Sage+/- Resource Report Resource Website |
RRID:RGD_14985210 | Rattus norvegicus | The bioinformatics software (Horizon Discovery, St. Louis, USA) was used to design a short guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons, Refseq: NC_005100.4, NM_001107517.1).sgRNA-Cas9 was performed by nucleofecting the sgRNA-Cas9 into rat C6 glial cells. Genomic DNA (gDNA) PCR products were subsequently generated from nucleofected C6 cells using primers flanking the sgRNA site (FOR: GCCAAAGCTTCCCCTAAAGT; REV: TGGGCGTCAAGTACATTCTG; 497bp amplicon). Embryos were collected from donor female Long Evans rats and injected with the validated sgRNA-Cas9. Then implanted into synchronized pseudopregnant Long Evans recipient female This mutant carries 4bp out of frame heterozygous deletion in exon 7 of the Cyfip1, resulting bioinformatics prediction of an early stop codon in exon 8. | 14985210 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14985210 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
SD-Dnmt1tm1(Myh6-cre)Cqin Resource Report Resource Website 1+ mentions |
RRID:RGD_126925139 | Rattus norvegicus | To specifically knockout Dnmt1 in the myocardium, Cre-loxP system was used by crossing alpha -MHC-Cre rats with Dnmt1 cKO rats. Dnmt1+/- offspring positive for the alpha MHC-Cre transgene (double-positive) were selected. In the second round of crossbreeding, the double-positive rats were crossed with Dnmt1 cKO rats, and Dnmt1-/- offspring positive for the alpha MHC-Cre transgene were obtained as myocardium-specific Dnmt1-KO rats | 126925139 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126925139 | RGD | 2026-09-26 02:42:13 | 1 | |||||
|
F344-Atg16l1em8Rrrc Resource Report Resource Website 1+ mentions |
RRID:RGD_149735570 | Rattus norvegicus | CRISPR-Cas9-mediated knock-in of a single base pair polymorphism of guanine to alanine in exon 10, resulting in a threonine to alanine substitution at amino acid position 299 in the rat. Mimics the same nucleotide substitution for the threonine to alanine substitution at amino acid position 300 in humans (T300A), Homozygosity for this allele is embryonic lethal. RRRC | 149735570 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2021-07-23) | 149735570 | RGD | 2026-09-26 02:42:13 | 1 | |||||
|
SD-Lrp5em3Vari Resource Report Resource Website |
RRID:RGD_41404651 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce an inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos. | 41404651 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 41404651 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
WI.SD-PcloTn(sb-B-Geo)Fkh Resource Report Resource Website |
RRID:RGD_41408339 | Rattus norvegicus | The Sprague-Dawley transposon mutagenesis spermatogonial gene trap library was screen to generate rats with a disrupted Pclo gene in Wistar rat background. The transposon element was integrated into exon 3 of the Pclo genomic sequence, leading to a premature stop in the reading frame. | 41408339 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 41408339 | RGD | 2026-09-26 02:42:12 | 0 | |||||
|
W-Phf24em24Iexas Resource Report Resource Website |
RRID:RGD_38676452 | Rattus norvegicus | This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 24 and has a 141-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined. National BioResource Project for the Rat in Japan | 38676452 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-17) | 38676452 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
F344; W-Phf24em6(EGFP)Iexas Resource Report Resource Website |
RRID:RGD_38676453 | Rattus norvegicus | This strain (line No. 6) was establishe by CRISPR-Cas9 system at Osaka University and EGFP sequence was knock-in in Phf24 gene. Back ground strain is Crlj:Wistar (WI). Founder rats were crossed with F344/NSlc, and this strain was maintained by crossing with F344/NSlc (F2 or F3 generation, November 2017). At the point of sperm cryopreservation, this strain is not "congenic" strain (backcross generation was <5 generations), but background is mix of Crlj:Wistar and F344/NSlc. National BioResource Project for the Rat in Japan | 38676453 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-17) | 38676453 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
SS-Prr5em1Mcwi Resource Report Resource Website |
RRID:RGD_14398463 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in the exon 1 of the gene. Contact MCW rat distribution at [email protected] | 14398463 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2019-04-19) | 14398463 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
F344-Phf24em2Kyo Resource Report Resource Website |
RRID:RGD_38676450 | Rattus norvegicus | In 2013, F344/Stm female rat deleted 392b (delta392) of KIAA1045 (Phf24) was generated by Platinum TALEN methods. Although spontaneous GTCS is not observed, seizure susceptibility is increased and kindling induced by PTZ is promoted. In addition, locomotor activity is increased, disturbed behavior and spacial memory are decreased, and emotional behavior is increased due to unpleasant stimulation. National BioResource Project for the Rat in Japan | 38676450 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2021-07-01) | 38676450 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
WI-Prdm14em10Nips Resource Report Resource Website |
RRID:RGD_41457452 | Rattus norvegicus | Prdm14 mutation was induced by introducing ribonucleic complexes (crRNA, tract RNA and Cas9 protein) into Crlj:WI rat embryos using electroporator. The resulting mutation is a 4412-bp deletion in exon 1 to 4. Homozygous Prdm14 knocked-out rats have the germ cell-deficient phenotype. Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN | 41457452 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-24) | 41457452 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
SD-Lrp5em1Vari Resource Report Resource Website |
RRID:RGD_41404646 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 18-bp deletion of exon 2 in the rat Lrp5 gene of Crl:SD embryos. | 41404646 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 41404646 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
F344.LE-ROSA26 em1(LTR-nLuc)Ottc Resource Report Resource Website |
RRID:RGD_38508893 | Rattus norvegicus | The mutated ROSA26 locus of LE-(ROSA)26 em1(LTR-nLuc)Ottc (RGD:13208223) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of mutated locus. The LE donor is CRISPR/Case9 knock-in strain that has cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. | 38508893 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38508893 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
WIC-Sparcem1Kykn Resource Report Resource Website |
RRID:RGD_39128166 | Rattus norvegicus | By CRISPR/Cas9 system, mutation was introduced in Sparc gene of Wistar-Imamichi rat. 7 bp deletion around Exon7. National BioResource Project for the Rat in Japan | 39128166 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-23) | 39128166 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
WIC-Cspg4em2Kyst Resource Report Resource Website |
RRID:RGD_39128162 | Rattus norvegicus | By CRISPR/Cas9 system, mutation was introduced in Cspg4 gene of Wistar-Imamichi rat. 7 bp deletion on Exon1. National BioResource Project for the Rat in Japan | 39128162 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-23) | 39128162 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
F344-Il2rgem1IexasRag2em1Iexas Resource Report Resource Website 1+ mentions |
RRID:RGD_38599190 | Rattus norvegicus | This strain was established by targeting Il2rg gene and Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation.This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on X chromosome and 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. The sexual maturation is a bit late. National BioResource Project for the Rat in Japan | 38599190 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2020-09-14) | 38599190 | RGD | 2026-09-26 02:42:13 | 1 | |||||
|
SD-Htr7em1Msu Resource Report Resource Website |
RRID:RGD_14696715 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant; this induced an 11 bp deletion in exon 1 and a 4 bp deletion in exon 2 of the Htr7 gene. | 14696715 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14696715 | RGD | 2026-09-26 02:42:12 | 0 | |||||
|
SS-Vwfem3Mcwi-/- Resource Report Resource Website |
RRID:RGD_18182946 | Rattus norvegicus | CRISPR/Cas9 mediated gene editing was used to delete a 130,921bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos Contact MCW rat distribution at [email protected] | 18182946 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-01-14) | 18182946 | RGD | 2026-09-26 02:42:12 | 0 | |||||
|
W-Gnrh1tm1(cre)Aeh Resource Report Resource Website |
RRID:RGD_35668859 | Rattus norvegicus | This model was generated using zinc finger nuclease (ZFN) method. Cre recombinase was expressed under the control of the endogenous Gnrh1 gene by inserting an internal ribosomal entry site (IRES)-Cre cassette 30bp downstream from the translational stop site of the Gnrh1 open reading frame. This was achieved by pronuclear co-injection of zinc finger nucleases (ATCCACAACATCCGAGTGtgacattGACGCTGAGATCCATGAC; cleavage site in lower case) along with a donor plasmid containing two 800bp homologous arms (HA) flanking IRES-Cre into a one-cell stage rat embryo. (1.) Allan Herbison at Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK.; (2.) Vincent Prevot in INSERM, Lille, France. | 35668859 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2020-07-09) | 35668859 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
F344 -Aspaem34Kyo Hcn1em1Kyo Resource Report Resource Website |
RRID:RGD_150429634 | Rattus norvegicus | F344-Aspaem34Kyo (RGD:11564349) and F344-Hcn1em1Kyo (RGD:38676253) rats from the National BioResource Project-Rat were intercrossed to produce F1 hybrids and then to obtain F2 progeny. Rats homozygous for both Aspa and Hcn1 knockout alleles were selected from among F2 progeny and were used to generate the F344-Aspaem34Kyo/Hcn1em1Kyo double- knockout strain. | 150429634 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150429634 | RGD | 2026-09-26 02:42:12 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
