Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MT15643 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027528 | Caenorhabditis elegans | mbtr-1(n4775) I. | WT phenotype. From Horvitz 2002 deletion library; deletion removes exons 4, 5, and 6 causing a frame shift after amino acid 165. This should remove last three MBT repeats. Y48G1A.6. | WBGene00021661(mbtr-1) | WBGene00021661(mbtr-1) | WB-STRAIN:WBStrain00027528 | WormBase (WB) | WB | available | WB-STRAIN:MT15643, CGC_MT15643 | WormBase | 2026-11-07 10:09:37 | 0 | |||
|
MT15695 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027529 | Caenorhabditis elegans | nIs175 IV; ceh-34(4796) V. | nIs175 [ceh-28p::4xNLS::GFP + lin-15(+)] IV. Extra GFP+ M4 observed in nIs175. Reference: Takashi H, et al. PNAS 2010 Aug 31;107(35):15479-84. | WBGene00000455(ceh-34) | WBGene00000455(ceh-34) | WB-STRAIN:WBStrain00027529 | WormBase (WB) | WB | available | WB-STRAIN:MT15695, CGC_MT15695 | WormBase | 2026-11-07 10:09:37 | 0 | |||
|
MT15537 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027524 | Caenorhabditis elegans | unc-30(e191) lin-54(n3423) IV/nT1 [qIs51] (IV;V); lin-15A(n767) X. | Heterozygotes are Muv and GFP+ and segregate SteUncMuv GFP- and dead eggs. n3423 is PVul and sterile when alone; Muv in synMuv class A background. | WBGene00003004(lin-15)|WBGene00003037(lin-54)|WBGene00006766(unc-30)|WBGene00023498(lin-15A) | WBGene00003004(lin-15), WBGene00003037(lin-54), WBGene00006766(unc-30), WBGene00023498(lin-15A) | WB-STRAIN:WBStrain00027524 | WormBase (WB) | WB | available | WB-STRAIN:MT15537, CGC_MT15537 | WormBase | 2026-11-07 10:09:37 | 0 | |||
|
MT15563 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027525 | Caenorhabditis elegans | nDf53 III; mir-58.1(n4640) IV; nDf54 X. | Made_by: Horvitz Lab|"Sick strain. mir-80 and mir-227 are deleted in nDf53. mir-81, mir-82, T02D1.2 are deleted in nDf54. Deletion breakpoints for n4640 are:CCGGCCAAATCTAGAACTGC / AAGAGTACGGTCTTG...GACTGAGCTAGAGTG / ACCTCTGATAATACGGAACGG. Deletion breakpoints for nDf53 are: ACTCATTTCGTTCGCCAGAAATTC / TCAGTTTGTGTA...ATAGCAGAGGT / ATTAGGAGAGTATAGACATCGAAAGCA. Deletion breakpoints for nDf54 are AAAATTTTTAAATTCTGAAATTAG / TTAAAAAACTGG...ATGAGTGGCAAA / AACTGATTGTGAGTAATTGTCATCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects." | WBGene00003286(mir-58.1) | WBGene00003286(mir-58.1) | WB-STRAIN:WBStrain00027525 | WormBase (WB) | WB | available | WB-STRAIN:MT15563, CGC_MT15563 | WormBase | 2026-11-07 10:09:37 | 0 | |||
|
MT15501 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027522 | Caenorhabditis elegans | mir-83(n4638) IV. | Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab" | WBGene00003311(mir-83) | WBGene00003311(mir-83) | WB-STRAIN:WBStrain00027522 | WormBase (WB) | WB | available | WB-STRAIN:MT15501, CGC_MT15501 | WormBase | 2026-11-07 10:09:37 | 0 | |||
|
MT16506 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027560 | Caenorhabditis elegans | mir-254(n4470) X. | Deletion breakpoints are: AAAATTTATTGAATTTTT / ATGAAGAATTACTATAAT...TCCAGGAGTGCAGTACGA / TCTCGAACCATGTTTTCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members" | WBGene00003348(mir-254) | WBGene00003348(mir-254) | WB-STRAIN:WBStrain00027560 | WormBase (WB) | WB | available | WB-STRAIN:MT16506, CGC_MT16506 | WormBase | 2026-11-07 10:09:38 | 0 | |||
|
MT16532 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027563 | Caenorhabditis elegans | lin-61(n3447) I; lin-38(n751) II. | Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71. | WBGene00003041(lin-61)|WBGene00013006(lin-38) | WBGene00003041(lin-61), WBGene00013006(lin-38) | WB-STRAIN:WBStrain00027563 | WormBase (WB) | WB | available | WB-STRAIN:MT16532, CGC_MT16532 | WormBase | 2026-11-07 10:09:38 | 0 | |||
|
MT16471 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027557 | Caenorhabditis elegans | mir-60(n4947) II. | Deletion breakpoints are:GAAACTTGTTCTGATACAGTA / ATTTTCAAAGAACCATCCATG...GGGCTTATGGAATGGTAG / ATAGTTGAGACACAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GAAACTTGTTCTGATACAGTA / ATTTTCAAAGAACCATCCATG...GGGCTTATGGAATGGTAG / ATAGTTGAGACACAGAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab" | WBGene00003288(mir-60) | WBGene00003288(mir-60) | WB-STRAIN:WBStrain00027557 | WormBase (WB) | WB | available | WB-STRAIN:MT16471, CGC_MT16471 | WormBase | 2026-11-07 10:09:38 | 1 | |||
|
MT16492 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027558 | Caenorhabditis elegans | uaf-1(n4588) III. | Suppressor of unc-93(e1500). Weak maternal effect sterile and dumpy. Reference: Ma L, Horvitz HR. PLoS Genet. 2009 Nov;5(11):e1000708. | WBGene00006697(uaf-1) | WBGene00006697(uaf-1) | WB-STRAIN:WBStrain00027558 | WormBase (WB) | WB | available | WB-STRAIN:MT16492, CGC_MT16492 | WormBase | 2026-11-07 10:09:38 | 2 | |||
|
MT16337 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027553 | Caenorhabditis elegans | mir-245(n4798) I. | Deletion breakpoints are:AACCTTAATAAACAAATTTTA / TTAGATTTGTTTCTGAA...GATAGTGACTTTCTTGAC / AAAACTTCCTAGCGCCATCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:AACCTTAATAAACAAATTTTA / TTAGATTTGTTTCTGAA...GATAGTGACTTTCTTGAC / AAAACTTCCTAGCGCCATCT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab" | WBGene00003339(mir-245) | WBGene00003339(mir-245) | WB-STRAIN:WBStrain00027553 | WormBase (WB) | WB | available | WB-STRAIN:MT16337, CGC_MT16337 | WormBase | 2026-11-07 10:09:38 | 0 | |||
|
MT16429 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027555 | Caenorhabditis elegans | set-6(tm1611) lin-15A(n767) X. | Mutagen:TMP+UV|"Mutagen:TMP/UV"|"Reference: Andersen EC & Horvitz HR., Development. 2007 Aug;134(16):2991-9." | WBGene00003004(lin-15)|WBGene00008206(set-6)|WBGene00023498(lin-15A) | WBGene00003004(lin-15), WBGene00008206(set-6), WBGene00023498(lin-15A) | WB-STRAIN:WBStrain00027555 | WormBase (WB) | WB | available | WB-STRAIN:MT16429, CGC_MT16429 | WormBase | 2026-11-07 10:09:38 | 0 | |||
|
MT16309 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027546 | Caenorhabditis elegans | mir-247&mir-797(n4505) X. | Deletion breakpoints are: CCAGTGTTACCACCGCTTGCTACAAACGGC / AAAAAATTTGAA...CAAAAATTTAT / CACATGAAATTATACCAAACAGTCAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members" | WBGene00003341(mir-247)|WBGene00045358(mir-797) | WBGene00003341(mir-247), WBGene00045358(mir-797) | WB-STRAIN:WBStrain00027546 | WormBase (WB) | WB | available | WB-STRAIN:MT16309, CGC_MT16309 | WormBase | 2026-11-07 10:09:38 | 0 | |||
|
MT16311 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027548 | Caenorhabditis elegans | mir-77(n4286) II. | Deletion breakpoints are:CTACAAAAACTATTCCATTC / AAAAAACGGCTGTCAGTGC...AGAGACGATTTGTGTCGA / TTTACGAAATTTTCCTCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CTACAAAAACTATTCCATTC / AAAAAACGGCTGTCAGTGC...AGAGACGATTTGTGTCGA / TTTACGAAATTTTCCTCG.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab" | WBGene00003305(mir-77) | WBGene00003305(mir-77) | WB-STRAIN:WBStrain00027548 | WormBase (WB) | WB | available | WB-STRAIN:MT16311, CGC_MT16311 | WormBase | 2026-11-07 10:09:38 | 0 | |||
|
MT16113 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027542 | Caenorhabditis elegans | nDf66 III/+. | Made_by: Ezequiel Alvarez-Saa|"Unbalanced heterozygous stock! Needs to be followed by PCR." | WB-STRAIN:WBStrain00027542 | WormBase (WB) | WB | available | WB-STRAIN:MT16113, CGC_MT16113 | WormBase | 2026-11-07 10:09:38 | 0 | |||||
|
MT16133 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027543 | Caenorhabditis elegans | set-24(n4909) II. | Reference: Development 134(16):2991-9 (2007). | WBGene00012845(set-24) | WBGene00012845(set-24) | WB-STRAIN:WBStrain00027543 | WormBase (WB) | WB | available | WB-STRAIN:MT16133, CGC_MT16133 | WormBase | 2026-11-07 10:09:38 | 0 | |||
|
MT17810 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027582 | Caenorhabditis elegans | mir-1(n4102) I. | Deletion breakpoints are: CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP" | WBGene00003260(mir-1) | WBGene00003260(mir-1) | WB-STRAIN:WBStrain00027582 | WormBase (WB) | WB | available | PMID:38555276 | WB-STRAIN:MT17810, CGC_MT17810 | WormBase | 2026-11-07 10:09:38 | 0 | ||
|
MT17848 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027583 | Caenorhabditis elegans | mir-2(n4108) I; nDf49 II; nDf59 V; mir-247(n4505) X. | Made_by: Ezequiel Alvarez-Saa|"mir-2 family and most of mir-44 family are removed in this strain (mir-45 is present). Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73." | WBGene00003261(mir-2)|WBGene00003341(mir-247) | WBGene00003261(mir-2), WBGene00003341(mir-247) | WB-STRAIN:WBStrain00027583 | WormBase (WB) | WB | available | WB-STRAIN:MT17848, CGC_MT17848 | WormBase | 2026-11-07 10:09:38 | 0 | |||
|
MT17997 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027584 | Caenorhabditis elegans | mir-235(n4504) I. | Deletion breakpoints are: ATCGGCCATCAGAACAGTGCAAGAAAT / TTGAGAAATATG...ATCCACAGGTGGT / GTCATCTGAAGAAAGGACACACATACATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members" | WBGene00003328(mir-235) | WBGene00003328(mir-235) | WB-STRAIN:WBStrain00027584 | WormBase (WB) | WB | available | PMID:38594249 | WB-STRAIN:MT17997, CGC_MT17997 | WormBase | 2026-11-07 10:09:38 | 0 | ||
|
MT17676 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027581 | Caenorhabditis elegans | mir-45(n4280) II; nDf59 V; mir-247(n4505) X. | Made_by: Ezequiel Alvarez-Saa|"nDf59 removes mir-61 and mir-250. mir-6, mir-247, and mir-45 are related in sequence. Reference: Curr Bio (2010) 20:367-73." | WBGene00003273(mir-45)|WBGene00003341(mir-247) | WBGene00003273(mir-45), WBGene00003341(mir-247) | WB-STRAIN:WBStrain00027581 | WormBase (WB) | WB | available | WB-STRAIN:MT17676, CGC_MT17676 | WormBase | 2026-11-07 10:09:38 | 0 | |||
|
MT17463 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027579 | Caenorhabditis elegans | set-25(n5021) III. | Contained background Let mutation that was lost during outcrossing. Reference: Development 134(16):2991-9 (2007).|"Made_by: Erik Anderson" | WBGene00012802(set-25) | WBGene00012802(set-25) | WB-STRAIN:WBStrain00027579 | WormBase (WB) | WB | available | PMID:33594200 | WB-STRAIN:MT17463, CGC_MT17463 | WormBase | 2026-11-07 10:09:38 | 2 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
