Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00033453
Source Database: WormBase (WB)
Affected Genes: WBGene00003225(mev-1)
Genomic Alteration: WBGene00003225(mev-1)
Availability: unknown
Source References: PMID:26108372
Synonyms: mev-1(tr413) III.
Alternate IDs: WB-STRAIN:RP2705
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033453 Copy
http://www.wormbase.org/db/get?name=WBStrain00033456
Source Database: WormBase (WB)
Affected Genes: WBGene00003225(mev-1)
Genomic Alteration: WBGene00003225(mev-1)
Availability: unknown
Source References: PMID:26108372
Synonyms: mev-1(tr424) III.
Alternate IDs: WB-STRAIN:RP2749
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033456 Copy
http://www.wormbase.org/db/get?name=WBStrain00033593
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: unc-119(tm4063) III; stIs10453.
Alternate IDs: WB-STRAIN:RW10453
Notes: Made_by: DKV/RJT/PW|"stIs10453 [elt-2::TY1::EGFP::3xFLAG + unc-119(+)]."
Proper citation: RRID:WB-STRAIN:WBStrain00033593 Copy
http://www.wormbase.org/db/get?name=WBStrain00033694
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: unc-119(ed3) III; stIs11383.
Alternate IDs: WB-STRAIN:RW11383
Notes: Made_by: E Preston/J Murray|"stIs11383 [Y71G12B.6::H1-wCherry + unc-119(+)]."
Proper citation: RRID:WB-STRAIN:WBStrain00033694 Copy
http://www.wormbase.org/db/get?name=WBStrain00033875
Source Database: WormBase (WB)
Affected Genes: WBGene00022425(plst-1)
Genomic Alteration: WBGene00022425(plst-1)
Availability: unknown
Source References: PMID:28400443, PMID:31160462
Synonyms: plst-1(msn190[plst-1::gfp]) IV.
Alternate IDs: WB-STRAIN:RZB213
Notes: Reference WBPaper00056840 added based on published strain data identified by Textpresso literature search.
Proper citation: RRID:WB-STRAIN:WBStrain00033875 Copy
http://www.wormbase.org/db/get?name=WBStrain00033876
Source Database: WormBase (WB)
Affected Genes: WBGene00022425(plst-1)
Genomic Alteration: WBGene00022425(plst-1)
Availability: unknown
Source References: PMID:28400443
Synonyms: plst-1(msn190[plst-1::gfp]) IV; zbIs2(pie-1::lifeACT::RFP).
Alternate IDs: WB-STRAIN:RZB217
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033876 Copy
http://www.wormbase.org/db/get?name=WBStrain00033920
Source Database: WormBase (WB)
Affected Genes: WBGene00001790(gst-42)
Genomic Alteration: WBGene00001790(gst-42)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SD1145
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033920 Copy
http://www.wormbase.org/db/get?name=WBStrain00033922
Source Database: WormBase (WB)
Affected Genes: WBGene00016097(C25E10.8)
Genomic Alteration: WBGene00016097(C25E10.8)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SD1147
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033922 Copy
http://www.wormbase.org/db/get?name=WBStrain00033925
Source Database: WormBase (WB)
Affected Genes: WBGene00000412(cdr-1)
Genomic Alteration: WBGene00000412(cdr-1)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SD1158
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033925 Copy
http://www.wormbase.org/db/get?name=WBStrain00033928
Source Database: WormBase (WB)
Affected Genes: WBGene00000615(col-38)
Genomic Alteration: WBGene00000615(col-38)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SD1168
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033928 Copy
http://www.wormbase.org/db/get?name=WBStrain00033931
Source Database: WormBase (WB)
Affected Genes: WBGene00003473(mtl-1)|WBGene00004010(pha-1)
Genomic Alteration: WBGene00003473(mtl-1), WBGene00004010(pha-1)
Availability: unknown
Synonyms: pha-1(e2123) III; mvEx5506.
Alternate IDs: WB-STRAIN:SD1172
Notes: mvEx5506 [mtl-1p::GFP + pha-1(+)]. Maintain at 25C to select for presence of the array.
Proper citation: RRID:WB-STRAIN:WBStrain00033931 Copy
http://www.wormbase.org/db/get?name=WBStrain00033934
Source Database: WormBase (WB)
Affected Genes: WBGene00001789(gst-41)
Genomic Alteration: WBGene00001789(gst-41)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SD1175
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033934 Copy
http://www.wormbase.org/db/get?name=WBStrain00033935
Source Database: WormBase (WB)
Affected Genes: WBGene00006207(str-162)
Genomic Alteration: WBGene00006207(str-162)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SD1176
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033935 Copy
http://www.wormbase.org/db/get?name=WBStrain00033918
Source Database: WormBase (WB)
Affected Genes: WBGene00011244(R11D1.3)
Genomic Alteration: WBGene00011244(R11D1.3)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SD1139
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033918 Copy
http://www.wormbase.org/db/get?name=WBStrain00034024
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: unc-119(ed3) III; gaEx232.
Alternate IDs: WB-STRAIN:SD1823
Notes: gaEx207 [sod-3p::mCherry + aakg-2(sta2) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.|"gaEx232 [aakg-2(sta2)(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of activated AAKG-2. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780."
Proper citation: RRID:WB-STRAIN:WBStrain00034024 Copy
http://www.wormbase.org/db/get?name=WBStrain00034114
Source Database: WormBase (WB)
Affected Genes: WBGene00003976(pes-1)
Genomic Alteration: WBGene00003976(pes-1)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SM1535
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00034114 Copy
http://www.wormbase.org/db/get?name=WBStrain00034121
Source Database: WormBase (WB)
Affected Genes: WBGene00008205(sams-1)
Genomic Alteration: WBGene00008205(sams-1)
Availability: unknown
Synonyms: sams-1(ssd206) X.
Alternate IDs: WB-STRAIN:SOZ471
Notes: no longer available from the CGC|"sams-1 (a.k.a.- drop-4) Class IV supersized lipid droplet mutant. GCT-->GTT mutation. 5' flanking sequence: agatccaaatgcaaaggttg. 3' flanking sequence: ttgcgagaccgtaacaaaaa References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846."
Proper citation: RRID:WB-STRAIN:WBStrain00034121 Copy
http://www.wormbase.org/db/get?name=WBStrain00034105
Source Database: WormBase (WB)
Affected Genes: WBGene00003937(pax-1)
Genomic Alteration: WBGene00003937(pax-1)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SM202
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00034105 Copy
http://www.wormbase.org/db/get?name=WBStrain00034341
Source Database: WormBase (WB)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SP978
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00034341 Copy
http://www.wormbase.org/db/get?name=WBStrain00034492
Source Database: WormBase (WB)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:ST205
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00034492 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.