Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207494
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13207494
Notes: CRISPR/Cas9 system was used to introduce a 22-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13207494 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13204756
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13204756
Notes: CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 of the rat Pappa2 gene of SS.BN-(D13Hmgc1048-D13Hmgc1050)/Mcwi rat embryos. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13204756 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13800838
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13800838
Notes: CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13800838 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207488
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13207488
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrnb4 gene of LEW/NCrl rat embryos. The resulting mutation is a 4-bp deletion of exon 4 in the Chrnb4 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13207488 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13208231
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13208231
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the exon 4 of the Tph1 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13208231 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207497
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13207497
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Kcnj13 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 2 in the Kcnj13 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13207497 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394496
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 14394496
Notes: CRISPR/Cas9 system was used to introduce a 2-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_14394496 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=25330091
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 25330091
Notes: CRISPR/Cas9 system was used to introduce a 11-bp deletion in exon 19 of rat Rictor gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_25330091 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139885
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 4139885
Notes: This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.
Proper citation: RRID:RGD_4139885 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131910
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 5131910
Notes: This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_5131910 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484582
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 6484582
Notes: This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_6484582 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10002794
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 10002794
Notes: This strain was produced by injecting TALENs targeting the sequence CTTAGACAACTCTCAATAGCTttatgggcctcggccAAGCGGCATGGAAGGAGGC into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_10002794 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=1599758
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: RGD_1599758, 1599758, RRRC_415, RRRC_0415, RRRC_00415
Notes: Male founders were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. The E124D mutation was generated from the codon change GAG/GAT. Rat Resource and Research Center
Proper citation: RRID:RRRC_00415 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131922
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 5131922
Notes: This strain was produced by injecting ZFNs targeting the sequence CTCACCCTGTGCGTCctgctgTCCCAGGTAGGGAATG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_5131922 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131952
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 5131952
Notes: This strain was produced by injecting ZFNs targeting the sequence CCTGGGGACTTCACACCCACccattcCCATAGTGCACTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4.
Proper citation: RRID:RGD_5131952 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131933
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 5131933
Notes: This strain was produced by injecting ZFNs targeting the sequence CGAGTGGGCCATgtgggCCAACGAACAGGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 36-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_5131933 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484564
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 6484564
Notes: This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_6484564 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509994
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 5509994
Notes: This strain was produced by injecting ZFNS targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 7 in SS/JrHsdMcwi.
Proper citation: RRID:RGD_5509994 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509988
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 5509988
Notes: This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 138-bp deletion of part of intron 1 and exon 2.
Proper citation: RRID:RGD_5509988 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6483453
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 6483453
Notes: This allele was made by ZFN mutagenesis. The resulting mutation is a 37-bp frameshift deletion in exon 1 (del 74-110)
Proper citation: RRID:RGD_6483453 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
