Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 20 showing 381 ~ 400 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00037280

http://www.wormbase.org/db/get?name=WBStrain00037280

Source Database: WormBase (WB)
Affected Genes: WBGene00000156(apr-1)|WBGene00000254(bli-4)
Genomic Alteration: WBGene00000156(apr-1), WBGene00000254(bli-4)
Availability: available
Synonyms: apr-1(ok2970) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2355, CGC_VC2355
Notes: K04G2.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2970 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGATTTGTGATGGCACAGT. External right primer: GCAGCACCAGAAGTTGATGA. Internal left primer: ATGGTAACGATTTTCCAGCG. Internal right primer: TGGTTCTTCAGCAGTTAATCCA. Internal WT amplicon: 1205 bp. Deletion size: 665 bp. Deletion left flank: TCATCAATTGACGTCTCAACAGCAGAACAC. Deletion right flank: GCTCAGACTGGTCTCCACAACAACAATTAC. Insertion Sequence: AGGACACCCAGCGATCATAACGGCATTGATGTGGCAAGAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037280 Copy   


  • RRID:WB-STRAIN:WBStrain00037287

http://www.wormbase.org/db/get?name=WBStrain00037287

Source Database: WormBase (WB)
Affected Genes: WBGene00008711(F11E6.8)
Genomic Alteration: WBGene00008711(F11E6.8)
Availability: available
Synonyms: F11E6.8(gk1178) IV.
Alternate IDs: WB-STRAIN:VC2365, CGC_VC2365
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1178) in F11E6.8, detectable by PCR using the following primers. External left primer: ACATATTCGACAAGGCACCC. External right primer: CACCCTTCGAGTCTACCCAG. Internal left primer: GCGAGTGAAAGGATCTGGAG. Internal right primer: TGGTGAGGGAATTGGAAAGA. Internal WT amplicon: 2406 bp. Deletion size: 1746 bp. Deletion left flank: ATTTTCCCATTTAGGTATACAAAACTTACA. Deletion right flank: GAGGCAAACTTCTCACTTCTTGAAACATTT. Validation: gk1178 passed by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037287 Copy   


  • RRID:WB-STRAIN:WBStrain00037284

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037284

Source Database: WormBase (WB)
Affected Genes: WBGene00020757(ucr-2.3)
Genomic Alteration: WBGene00020757(ucr-2.3)
Availability: available
Synonyms: ucr-2.3(ok3073) III.
Alternate IDs: WB-STRAIN:VC2360, CGC_VC2360
Notes: Made_by: Vancouver KO Group|"T24C4.1. External left primer: CGTGCTGGTTCTCGTTATGA. External right primer: CATATGCAGAGATGGCGAGA. Internal left primer: TCACTCAGCCTGGACTTGTG. Internal right primer: TTCTGGACCGTTGTAGAGGG. Internal WT amplicon: 1135 bp. Deletion size: 415 bp. Deletion left flank: GAATTGTGTTTGAGGATATTCATCGCGCTG. Deletion right flank: CTTCTCCACTGAAATTTGCATCACTTCCAG. Insertion Sequence: TTCA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037284 Copy   


  • RRID:WB-STRAIN:WBStrain00037246

http://www.wormbase.org/db/get?name=WBStrain00037246

Source Database: WormBase (WB)
Affected Genes: WBGene00022397(Y97E10AR.2)
Genomic Alteration: WBGene00022397(Y97E10AR.2)
Availability: available
Synonyms: Y97E10AR.2(ok3098) V.
Alternate IDs: WB-STRAIN:VC2310, CGC_VC2310
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y97E10AR.2. External left primer: TTGCCGTTCACAGTATCCAA. External right primer: ACGTCGAACTGATCCCCATA. Internal left primer: GAAACTGGTGGAAACGCTGT. Internal right primer: GAACGCTTACGAATAGAAGAGCA. Internal WT amplicon: 1332 bp. Deletion size: 716 bp. Deletion left flank: CATCCGCACACTACAGGACCGGGTTTTGGA. Deletion right flank: ATCATTTCCATCAAACCCAGAATATATTTT."

Proper citation: RRID:WB-STRAIN:WBStrain00037246 Copy   


  • RRID:WB-STRAIN:WBStrain00037244

http://www.wormbase.org/db/get?name=WBStrain00037244

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00006059(stc-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00006059(stc-1)
Availability: available
Synonyms: stc-1(ok2829)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC2308, CGC_VC2308
Notes: F54C9.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2829 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAACCGCCAACGAGTACAAT. External right primer: CAACGGGATCATTGCTAGGT. Internal left primer: GCTAAAGCTGCCGTAATTGG. Internal right primer: TGGATTACCTCCACCACCTC. Internal WT amplicon: 1183 bp. Deletion size: 642 bp. Deletion left flank: TGCTTGAGTTACAAAAACTCCTCCTTGAAG. Deletion right flank: TCATTAAAACTTACAAGAAAGCAACGACAC. Insertion Sequence: TTAAAAC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037244 Copy   


  • RRID:WB-STRAIN:WBStrain00037245

http://www.wormbase.org/db/get?name=WBStrain00037245

Source Database: WormBase (WB)
Affected Genes: WBGene00014054(dbt-1)
Genomic Alteration: WBGene00014054(dbt-1)
Availability: available
Synonyms: ZK669.4(ok3001) II.
Alternate IDs: WB-STRAIN:VC2309, CGC_VC2309
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK669.4. Strain might be sensitive to hypochlorite; no survivors after mutliple attempts to clean by hypochlorite treatment. External left primer: TAGAGTGTTGAAAACGGGGG. External right primer: CCACACCAGCAGTTCGTAGA. Internal left primer: CATCAAGGGATAATTGGGCA. Internal right primer: GGAACTGGAAAAGACGGAAG. Internal WT amplicon: 1181 bp. Deletion size: 401 bp. Deletion left flank: TGTCATGTTTATCGAATCGTGGGAGTTTTT. Deletion right flank: CATTTTCCATTTTCTCATCAGTTGTAGAAT. Insertion Sequence: T."

Proper citation: RRID:WB-STRAIN:WBStrain00037245 Copy   


  • RRID:WB-STRAIN:WBStrain00037250

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037250

Source Database: WormBase (WB)
Affected Genes: WBGene00012597(nhr-235)
Genomic Alteration: WBGene00012597(nhr-235)
Availability: available
Synonyms: nhr-235(gk1085) II.
Alternate IDs: WB-STRAIN:VC2317, CGC_VC2317
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y38E10A.19. External left primer: TTTTTCATTTTGTGTGGCGA. External right primer: AATTCTGTGGAACTCGGTGG. Internal left primer: TGCTTGGTAGCTTTGCTTCA. Internal right primer: GAGTCGTGGAGTCTTGGCAT. Internal WT amplicon: 1867 bp. Deletion size: 935 bp. Deletion left flank: ACTCAAAGCTTACGTTGGAAATTATGTCGG. Deletion right flank: CCGAAAATTTTCAAAAAATTTTAGGATCTA. Insertion Sequence: AAATTTTCCGAAAATTT."

Proper citation: RRID:WB-STRAIN:WBStrain00037250 Copy   


  • RRID:WB-STRAIN:WBStrain00037254

http://www.wormbase.org/db/get?name=WBStrain00037254

Source Database: WormBase (WB)
Affected Genes: WBGene00013794(dct-13)
Genomic Alteration: WBGene00013794(dct-13)
Availability: available
Synonyms: dct-13(gk992) IV.
Alternate IDs: WB-STRAIN:VC2323, CGC_VC2323
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y116A8C.17. External left primer: AGCGAGCATTGCAAAAAGAT. External right primer: TATGAATGTCCGTGCTCTGC. Internal left primer: AAGAGCTGAGCAATGCCAAT. Internal right primer: ACAGCGTTTGTTCCGTATCC. Internal WT amplicon: 785 bp. Deletion size: 94 bp. Deletion left flank: AATTGACACCTGGCTCCGTACTTGCAATAT. Deletion right flank: ATTTGCATGCTTCACCGTAAATGCATGTTT."

Proper citation: RRID:WB-STRAIN:WBStrain00037254 Copy   


  • RRID:WB-STRAIN:WBStrain00037251

http://www.wormbase.org/db/get?name=WBStrain00037251

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003144(max-2)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003144(max-2), WBGene00006787(unc-52)
Availability: available
Synonyms: max-2(ok2553)/mnC1 [dpy-10(e128) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:VC2320, CGC_VC2320
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y38F1A.10. Apparent homozygous lethal deletion chromosome balanced by recombination suppressor marked with dpy-10 and unc-52. Heterozygotes are WT and segregate WT, paralyzed Dpy mnC1 homozygotes and ok2553 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGACAGAAATCGACAGCAGG. External right primer: ACGGGAACCCCCATATACTC. Internal left primer: AAGCGGTAAATGACGGAATG. Internal right primer: TGTGTCTGTGTGTCTTCGCA. Internal WT amplicon: 3342 bp. Deletion size: approximately 2000 bp."

Proper citation: RRID:WB-STRAIN:WBStrain00037251 Copy   


  • RRID:WB-STRAIN:WBStrain00037252

http://www.wormbase.org/db/get?name=WBStrain00037252

Source Database: WormBase (WB)
Affected Genes: WBGene00001543(gcy-18)
Genomic Alteration: WBGene00001543(gcy-18)
Availability: available
Source References: PMID:21173231
Synonyms: gcy-18(ok3047) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2321, CGC_VC2321
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK896.8. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3047 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATCGCTAATCCACTGGAACG. External right primer: CGATCCTCCAACCAGAATGT. Internal left primer: CTGCAAAAGATTCGGACGAT. Internal right primer: GTGCCCTTTCCTTTCACTTG. Internal WT amplicon: 1263 bp. Deletion size: 517 bp. Deletion left flank: TTTCAGCAATAATCTATATGGCTCCTGAAC. Deletion right flank: GAATGTTAGAAGAAGCCAACATCCGTGCTG."

Proper citation: RRID:WB-STRAIN:WBStrain00037252 Copy   


  • RRID:WB-STRAIN:WBStrain00037257

http://www.wormbase.org/db/get?name=WBStrain00037257

Source Database: WormBase (WB)
Affected Genes: WBGene00015523(ztf-30)
Genomic Alteration: WBGene00015523(ztf-30)
Availability: available
Source References: PMID:34271120
Synonyms: C06E1.8(gk1061) III.
Alternate IDs: WB-STRAIN:VC2326, CGC_VC2326
Notes: C06E1.8. External left primer: CCCGCAAACAGGAAGAAATA. External right primer: CTGCTGCTCCAAAACATTGA. Internal left primer: GCACAGTTTGTTCCAATCCA. Internal right primer: TTCTTCTTCCTCCTCCGTCA. Internal WT amplicon: 2185 bp. Deletion size: 559 bp. Deletion left flank: ATTATTCAAAGTCCCCAATTCAAATACAGT. Deletion right flank: GTTTTCATTCTATTTCATATTTTTGTCTCC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00061672 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00037257 Copy   


  • RRID:WB-STRAIN:WBStrain00037255

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037255

Source Database: WormBase (WB)
Affected Genes: WBGene00001449(flp-6)
Genomic Alteration: WBGene00001449(flp-6)
Availability: available
Source References: PMID:38443452
Synonyms: flp-6(ok3056)ZK6.11(ok3738)
Alternate IDs: WB-STRAIN:VC2324, CGC_VC2324
Notes: F07D3.2. External left primer: ACTCCCCCTCATCCAAATTC. External right primer: TTTCGCGAATGAAGCTATGA. Internal left primer: CCCCACGTTACCAGATGATATT. Internal right primer: CCAGTTGGTCCTTACAAGAGC. Internal WT amplicon: 1129 bp. Deletion size: 421 bp. Deletion left flank: TATGTTTTTCTGTTCAACGTTTTTTATTTA. Deletion right flank: GTGGAAACCCAATGGAAATGGAAAAACGGA. Insertion Sequence: A.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037255 Copy   


  • RRID:WB-STRAIN:WBStrain00037260

http://www.wormbase.org/db/get?name=WBStrain00037260

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00012662(tmie-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00012662(tmie-1)
Availability: available
Synonyms: Y39A1C.1(ok3032) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2330, CGC_VC2330
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y39A1C.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3032 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCGTGGTGACTCCAAAACTT. External right primer: CTGCGTCTCCTCCTCTTCAC. Internal left primer: TTGGGTTTCCATGGTGACTT. Internal right primer: AAAAACCCGCATCTAACCAC. Internal WT amplicon: 1253 bp. Deletion size: 520 bp. Deletion left flank: CGAACCGTGGTGTCTCCAGGCGGGAATTCA. Deletion right flank: TTTTTGTAAATAAATTGAATTTTTAATATG. Insertion Sequence: TT."

Proper citation: RRID:WB-STRAIN:WBStrain00037260 Copy   


  • RRID:WB-STRAIN:WBStrain00037261

http://www.wormbase.org/db/get?name=WBStrain00037261

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003929(pat-2)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003929(pat-2)
Availability: available
Synonyms: pat-2(ok2148) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2332, CGC_VC2332
Notes: F54F2.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2148 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTCATCGTCTTGGATACG. External right primer: AAGTGAAGTTTGTCAGCCCG. Internal left primer: TCGTGTTTTTATTGGAGCCC. Internal right primer: CGACTATGAGATCGTGGCAA. Internal WT amplicon: 3238 bp. Deletion size: 1660 bp. Deletion left flank: CAGTTGTTGGAGATGATCAGTGGGGACGAT. Deletion right flank: TTTTATAATGAGACAAGTTCACAGCCATTT. Insertion Sequence: GTGGAGTGGAGAGATGTGGAGTGGGGAGTGGGGAGTGGGGA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037261 Copy   


  • RRID:WB-STRAIN:WBStrain00037264

http://www.wormbase.org/db/get?name=WBStrain00037264

Source Database: WormBase (WB)
Affected Genes: WBGene00013128(dxbp-1)
Genomic Alteration: WBGene00013128(dxbp-1)
Availability: available
Synonyms: Y52B11A.9(gk1120) I.
Alternate IDs: WB-STRAIN:VC2336, CGC_VC2336
Notes: Made_by: Vancouver KO Group|"This strain is homozygous for a deletion (gk1120) in Y52B11A.9, detectable by PCR using the following primers. External left primer: CAATCCCCTCTCTCATCCAA. External right primer: TATTTGCAACGACACTCCGA. Internal left primer: TGCATATGACGCTCTTCGTC. Internal right primer: TTCCAGCTTCTGCCAAATGT. Internal WT amplicon: 1563 bp. Deletion size: 405 bp. Deletion left flank: GGAGCTTTTCGGCTCAAATTATTGGAATAT. Deletion right flank: ACAAACTACAAAATTTCTAGCCTCTACCAA. Validation: gk1120 passed by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037264 Copy   


  • RRID:WB-STRAIN:WBStrain00037265

http://www.wormbase.org/db/get?name=WBStrain00037265

Source Database: WormBase (WB)
Affected Genes: WBGene00013785(nep-23)
Genomic Alteration: WBGene00013785(nep-23)
Availability: available
Synonyms: Y116A8C.4(ok3077) IV.
Alternate IDs: WB-STRAIN:VC2337, CGC_VC2337
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y116A8C.4. External left primer: CGACGTTGTTTCCAGGATTT. External right primer: TTCCACCCAACTCACATTCA. Internal left primer: GCGCTGAGCTCTCAAAGACT. Internal right primer: GACAAGCCCCATAAAGTCCA. Internal WT amplicon: 1215 bp. Deletion size: 526 bp. Deletion left flank: TGTATCACGCTTGCTCATCAATTGGTAGGA. Deletion right flank: TTTCTTCAAATAGTTATTTTAGAAATGCTC. Insertion Sequence: TCGACATCTTCCGGGTTTCCAGACCCATAAAATGTCGGTTGCTAGATAATAAATCAA."

Proper citation: RRID:WB-STRAIN:WBStrain00037265 Copy   


  • RRID:WB-STRAIN:WBStrain00037345

http://www.wormbase.org/db/get?name=WBStrain00037345

Source Database: WormBase (WB)
Affected Genes: WBGene00018202(F39F10.2)|WBGene00020004(R11E3.2)|WBGene00021246(Y22D7AL.7)|WBGene00022773(ZK616.3)
Genomic Alteration: WBGene00018202(F39F10.2), WBGene00020004(R11E3.2), WBGene00021246(Y22D7AL.7), WBGene00022773(ZK616.3)
Availability: available
Synonyms: Y22D7AL.7(gk3210) III; R11E3.2(gk3211) ZK616.3(gk3212) IV; F39F10.2(gk1161) X.
Alternate IDs: WB-STRAIN:VC2461, CGC_VC2461
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1161) in F39F10.2, detectable by PCR using the following primers. External left primer: GTGCTCACCGAGATGTCTGA. External right primer: GCTGATTTCGCTCAACACAA. Internal left primer: GACCCGGTAATTGAGCAGAA. Internal right primer: TGCGAACATTCGTTGAGTTC. Internal WT amplicon: 2489 bp. Deletion size: 500 bp. Deletion left flank: TTCAATTAGGATGTCGTAAACGCAGTGGCT. Deletion right flank: GTGATATCCTAAAAATTATGTTTAAGTTAT. Validation: gk1161 passed by CGH. Other deletions (gk3210, gk3211, gk3212) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037345 Copy   


  • RRID:WB-STRAIN:WBStrain00037352

http://www.wormbase.org/db/get?name=WBStrain00037352

Source Database: WormBase (WB)
Affected Genes: WBGene00012792(Y43D4A.6)
Genomic Alteration: WBGene00012792(Y43D4A.6)
Availability: available
Synonyms: Y43D4A.6(gk1142) IV.
Alternate IDs: WB-STRAIN:VC2476, CGC_VC2476
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y43D4A.6. Identified by PCR, validated by CGH. External left primer: ACGATAAACCAGCAGACGCT. External right primer: TTTGAAAACGGTGTGAAACG. Internal left primer: AACTGTGTTCGAAACCCTCG. Internal right primer: TCAAGCTCATTCGGATTTCA. Internal WT amplicon: 2337 bp. Deletion size: 1390 bp. Deletion left flank: CAAGTTTATCAACAACGTGAAACAGACAAT. Deletion right flank: CAGCAAAAAAATCACTTGCTCCAGTAATTC."

Proper citation: RRID:WB-STRAIN:WBStrain00037352 Copy   


  • RRID:WB-STRAIN:WBStrain00037353

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037353

Source Database: WormBase (WB)
Affected Genes: WBGene00011979(sysm-1)
Genomic Alteration: WBGene00011979(sysm-1)
Availability: available
Source References: PMID:32560629
Synonyms: T24B8.5(ok3236) II.
Alternate IDs: WB-STRAIN:VC2477, CGC_VC2477
Notes: Made_by: Vancouver KO Group|"T24B8.5. External left primer: CCGTCTCTCTCCGTTTTGTT. External right primer: CTACATCCGGCTGCCTATTC. Internal left primer: CTTTTCCGTCCGTTCGATT. Internal right primer: CCCTTGAATGCTTCTGGTTT. Internal WT amplicon: 1299 bp. Deletion size: 509 bp. Deletion left flank: TTTGGGCATTGTCTGAAATTTCAGATGAGA. Deletion right flank: GGTAAAGTTTAGAACAATTGAAGTGACAAA. Insertion Sequence: CTATAAAAACTACGTCAAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037353 Copy   


  • RRID:WB-STRAIN:WBStrain00037350

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037350

Source Database: WormBase (WB)
Affected Genes: WBGene00017510(nhr-178)
Genomic Alteration: WBGene00017510(nhr-178)
Availability: available
Synonyms: nhr-178(gk1158) V.
Alternate IDs: WB-STRAIN:VC2474, CGC_VC2474
Notes: F16B4.9. Identified by PCR, validated by CGH. External left primer: ACATCCATCTTTCTGGCGAC. External right primer: TTCGGAGTCACAAGTTGCAG. Internal left primer: GCGCACCCTGAACATAGTTT. Internal right primer: AAATATGGGAGCAGCGTTTG. Internal WT amplicon: 1511 bp. Deletion size: 502 bp. Deletion left flank: ATCTAAAATCGCGCTTTTGATTTTGTTCTG. Deletion right flank: ATATAAACGACTATATTTGCATTGAATTCA. Insertion Sequence: TAAACGACTATATTTGCATTGA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037350 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X