Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631721277
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 631721277
Notes: The mutant rats were generated using CRISPR/Cas9 technology to target upstream of exon 11 or downstream of exon 21 of rat Shank3. The resulting mutant carried approximately 26 kb deletions with the removal of the Shank3 exon 11–21 [email protected] at Department of Neurobiology, School of Basic Medical Sciences, Peking University, Beijing, China
Proper citation: RRID:RGD_631721277 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629142769
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 629142769
Notes: The is the wild type litter mate for the Dmd mutant: CD-Dmdem1Gene (RGD:629142768), Genethon; 1, bis rue de l’internationale23
91000 Evry, France
Proper citation: RRID:RGD_629142769 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629142768
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 629142768
Notes: The model was generated using a single guide RNA-Cas9 targeted to exon 45 of the rat Dmd gene on a Sprague-Dawley (CD®(SD), Crl:CD(SD)) background. One male founder with a 606 bp deletion encompassing Dmd exon 45 and spanning from 207 bp into the 3’ region of intron 44 to 223 bp into the 5’ region of intron 45,including exon 45, was selected for phenotyping. The heterozygous/hemizygous Dmd knock-out lines were used for breeding. Genethon; 1, bis rue de l’internationale23
91000 Evry, France
Proper citation: RRID:RGD_629142768 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616390066
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 616390066
Notes: To generate the 5p15.2 deletion in the rat, two CRISPR gRNAs were designed at syntenic loci in the rat genome: ATGTCGATGTCTTGTTAGGGTGG at Chr.2:83120000 (RGSC 6.0/rn6) and GCTGAGATGGCTTTCAGAAATGG at Chr.2:84800000 (RGSC 6.0/rn6), which induced ≈1.68 Mb chromosomal deletion. The Biocytogen Transgenic and Gene Targeting core injected 50 ng uL−1 of each gRNAs and 100 ng uL−1 Cas9 RNA into single‐cell SD rat zygotes. Embryos were cultured overnight and transferred to pseudopregnant females. PCR was used to screen for the deletion. PCR was performed using genomic ear or tail DNA, and the following primer pair: Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Distal Reverse‐TCATCAAAATGCACCAAAAGTGCAA (these primers generate ≈485 bp product). PCR primers were used to detect the breakpoint on the undeleted 5p15.2 interval (wild‐type allele): Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Proximal Reverse‐GGAGTAAGTCAACTGACTAGGGGACA (these primers generate ≈618 bp product).
Proper citation: RRID:RGD_616390066 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629020173
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 629020173
Notes: The Cre recombinase gene was knocked into exon 2 of the Drd2 gene using CRISPR/Cas9 genome editing. RRRC:00979
Proper citation: RRID:RGD_629020173 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405100723
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405100723
Notes: The CRISPR/Case9 knock-in of CAG-LSL-Ghsr (LSL: loxp-Stop-Loxp) to the ROSA 26 locus of LE rats has cre recombinase-dependent expression of rat Ghsr under the control of CAG promoter. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.
Proper citation: RRID:RGD_405100723 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616572806
Source Database: Rat Genome Database (RGD)
Genetic Background: recombinant_inbred
Availability: Unknown
Alternate IDs: 616572806
Notes: Embryo-rederived from breeder stock BXH10/Cub provided by Dr. Kren from Charles University, Department of Biology, Prague, Czech Republic, maintained at Medical College of Wisconsin RGD HRDP, contact HRDP
Proper citation: RRID:RGD_616572806 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616572805
Source Database: Rat Genome Database (RGD)
Genetic Background: recombinant_inbred
Availability: Unknown
Alternate IDs: 616572805
Notes: Embryo-rederived from breeder stock HXB5/Ipcv provided by Pravenec and Kren from the Prague colonies, maintained at Medical college of Wisconsin. RGD HRDP, contact Hybrid Rat Diversity Panel at
[email protected]
Proper citation: RRID:RGD_616572805 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=632522749
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Unknown
Alternate IDs: 632522749
Notes: This transgenic rat strain carrying human NR3C2 was developed on a Sprague-Dawley albino background. The transgene was constructed with the human NR3C2 (also know as MR) under the proximal P1 promotor in the 5′-flanking regions of exons 1alpha.
Proper citation: RRID:RGD_632522749 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=625776931
Source Database: Rat Genome Database (RGD)
Genetic Background: transchromosomal
Availability: Unknown
Alternate IDs: 625776931
Notes: Chimeric rats were generated using rBLK2i-1 (WDB/Nips-ES1/Nips, RGD: 10054010) to which human CYP3A cluster (4 coding genes: CYP3A4, CYP3A5, CYP3A7, and CYP3A43) was introduced. ES cells carrying the CYP3A chromosomal DNA were microinjected into the blastocoel cavity of Crlj:wi E4.5 blastocysts. Chromosome Engineering Research Center, Tottori University, Yonago, 683-8503 Tottori, Japan
Proper citation: RRID:RGD_625776931 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=625776930
Source Database: Rat Genome Database (RGD)
Genetic Background: transchromosomal
Availability: Unknown
Alternate IDs: 625776930
Notes: Chimeric rats were generated using rBLK2i-1 (WDB/Nips-ES1/Nips, RGD: 10054010) to which human UGT2 cluster (10 coding genes: UGT2B4, UGT2B7, UGT2B10, UGT2B11, UGT2B15, UGT2B17, UGT2B28, UGT2A1, UGT2A2, and UGT2A3) was introduced. ES cells carrying the UGT2 chromosomal DNA were microinjected into the blastocoel cavity of Crlj:wi E4.5 blastocysts. Chromosome Engineering Research Center, Tottori University, Yonago, 683-8503 Tottori, Japan
Proper citation: RRID:RGD_625776930 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1558661
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 1558661
Notes: Substrain of WKY rats maintained at International Medical Center of Japan, Tokyo
Proper citation: RRID:RGD_1558661 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=737943
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 737943
Notes: Substrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986 Harlan Rijswijk, Harlan Sprague Dawley, Indianapolis, IN
Proper citation: RRID:RGD_737943 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1302647
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 1302647
Notes: Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.
Proper citation: RRID:RGD_1302647 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=737885
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 737885
Notes: Roman High Avoidance strain selectively bred for good two-way avoidance acquisition, maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlands
Proper citation: RRID:RGD_737885 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1357186
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 1357186
Notes: This mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life. Harlan
Proper citation: RRID:RGD_1357186 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1357187
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 1357187
Notes: This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.
Proper citation: RRID:RGD_1357187 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1578697
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 1578697
Notes: Congenic strain was bred from BN.LEW-(D10Rat32-D10Rat221)/Ciml backcrossed to BN/Rj.
Proper citation: RRID:RGD_1578697 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1357182
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Unknown
Alternate IDs: 1357182
Notes: Wild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats.
Proper citation: RRID:RGD_1357182 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1357184
Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Unknown
Alternate IDs: 1357184
Notes: The obese and fatty condition appeared spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960 at the Laboratory of Comparative Pathology in Stow, Massachusetts. These came to Charles River in 1985 from a research colony maintained at a pharmaceutical company. Charles River Laboratories
Proper citation: RRID:RGD_1357184 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
