Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SS-Rrg2em1Mcwi Resource Report Resource Website |
RRID:RGD_629142772 | Rattus norvegicus | Cas9 and sgRNA targeting the sequence GCTTTGCAACTTGTGCAGCA were injected into SS embryos to mutate a CTCF binding site within the first intron of Golt1a. a 3-bp deletion rn6 chr13:50,545,341-50,545,343 resulted. Custom Rats at Medical College of Wisconsin, Email: [email protected] | 629142772 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-12-30) | 629142772 | RGD | 2026-09-26 02:42:18 | 0 | |||||
|
SS-Rrg3em1Mcwi Resource Report Resource Website |
RRID:RGD_629142773 | Rattus norvegicus | Cas9 and sgRNA targeting the sequence GGGCATCTTCTGCCACCTAC were injected into SS embryos to mutate a CTCF binding site within the first intron of Ren. An 11-bp deletion rn6 chr13:50,509,649-50,509,659 resulted. Custom Rats at Medical College of Wisconsin, Email: [email protected] | 629142773 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-12-30) | 629142773 | RGD | 2026-09-26 02:42:18 | 0 | |||||
|
SD-Tbx21em1Sage Resource Report Resource Website |
RRID:RGD_626469804 | Rattus norvegicus | This is a Tbx21 knockout rat created using ZFN technology targeting exon 1 coding sequences 378-412. The resulting mutation is a 22-bp deletion (392-413). Inotiv | 626469804 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2025-09-17) | 626469804 | RGD | 2026-09-26 02:42:17 | 0 | |||||
|
SD-Oxtrem1(cre)Grin Resource Report Resource Website |
RRID:RGD_632517841 | Rattus norvegicus | CRISPR/Cas9-mediated knock-in of an IRES-Cre cassette into the 3' UTR of the endogenous Oxtr gene. The line is maintained in the heterozygous state and preserves normal Oxtr expression. Availability Contact Email: [email protected],Central Institute of Mental Health | 632517841 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2026-01-28) | 632517841 | RGD | 2026-09-26 02:42:18 | 0 | |||||
|
SS-Del(2q)1Mcwi +/+ Resource Report Resource Website |
RRID:RGD_617148292 | Rattus norvegicus | Four single guide RNAs and SpCas9 targeting sequences ATGAAGTGCCTAGCTTCATT, GAAGCTAGGCACTTCATCTA, ATTCATAATGGGACACTCGA, and CCCAGCCTCAGATTCATAAT flanking a chromosome 2 region distal to Npr3 were targeted in SS/JrHsdMcwi embryos. A 29,508 bp deletion in chromosome 2 (rn6: chr2:61,845,176-61,874,684) resulted, along with an insertion of 3 nucleotides (TGG). Please contact: [email protected] | 617148292 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-07-07) | 617148292 | RGD | 2026-09-26 02:42:17 | 0 | |||||
|
SD-Gnalem2Hpng Resource Report Resource Website |
RRID:RGD_626419677 | Rattus norvegicus | Gnal knockout rats were generated by CRISPR/Cas9 technology. Exon1 of rat Gnal splicing variant 2 was targeted, resulting in a deletion of 1 base pair that corresponds to position 44 downstream of the translation start point ATG of the Gnal splicing variant 2. CRISPR technology details: self-synthesized Cas9 mRNA using px 330 vector, applying T7 transcription kit followed by Poly-Adenylation and Capping. No sequencing performed, whether Cas9 has been inserted into the rat genome is unknown. Homozygous: Approximately 25% body weight reduction; Smaller body size; Hyperactivity; Better rotarod performance than wild-type littermates.Heterozygous: No body weight change; No body size change; Hypo-activity; Worse rotarod performance than wild-type littermates. European Mouse Mutant Archive(EMMA) | 626419677 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2025-09-05) | 626419677 | RGD | 2026-09-26 02:42:17 | 0 | |||||
|
LE-Syngap1em1Sidb Resource Report Resource Website |
RRID:RGD_626170599 | Rattus norvegicus | This KO allele was generated by Sigma Advanced Genetic Engineering (SAGE) Labs (St. Louis, MO, US) by injecting CRISPR/Cas9 reagents and sgRNA targeting exon 8 (gtgcatagagcatgtcgtccAGG) into Long Evans (LE) zygotes. Founder #23 displayed a 2bp deletion and 1bp insertion, leading to a frameshift mutation in exon 8 of Syngap1, which prevents expression of the protein. Homozygous Syngap1 KO rats die perinatally, but heterozygous Syngap1 KO rats appear healthy and are fertile. Simons Initiative for the Developing Brain (SIDB), Institute for Neuroscience and Cardiovascular Research, University of Edinburgh, Edinburgh EH8 9XD, UK. Contact SIDB Scientific Officer for enquiries on rat distribution ([email protected]). | 626170599 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2025-09-02) | 626170599 | RGD | 2026-09-26 02:42:17 | 0 | |||||
|
LE-Drd2em1(Cre)Rrrc Resource Report Resource Website |
RRID:RGD_629020173 | Rattus norvegicus | The Cre recombinase gene was knocked into exon 2 of the Drd2 gene using CRISPR/Cas9 genome editing. RRRC:00979 | 629020173 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 629020173 | RGD | 2026-09-26 02:42:18 | 0 | |||||
|
LE-Csf1rem1Prdns Resource Report Resource Website |
RRID:RGD_626168248 | Rattus norvegicus | The CRISPR/Cas9 system was used to delete the FIRE ( Fms intronic regulatory element) enhancer of the Csf1r gene of LE rat embryos Clare Pridans Centre for Inflammation Research Institute for Regeneration and Repair The University of Edinburgh | 626168248 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2025-08-28) | 626168248 | RGD | 2026-09-26 02:42:17 | 0 | |||||
|
LE-ROSA26 em1(CAG-Ghsr)Ottc Resource Report Resource Website |
RRID:RGD_405100723 | Rattus norvegicus | The CRISPR/Case9 knock-in of CAG-LSL-Ghsr (LSL: loxp-Stop-Loxp) to the ROSA 26 locus of LE rats has cre recombinase-dependent expression of rat Ghsr under the control of CAG promoter. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. | 405100723 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405100723 | RGD | 2026-09-26 02:42:17 | 0 | |||||
|
WI-Ugt2em1YakazTc(HSA4-UGT2)Yakaz/Yakaz Resource Report Resource Website |
RRID:RGD_625777900 | Rattus norvegicus | Ugt2 (cluster) KO strain: The Ugt2 cluster was disrupted using the genome editing technology CRISPR/Cas9, and F1 rats (heterozygotes) were produced by crossing with Wistar (Crlj:WI) rats. The F1 rats were then crossed with each other to produce a homozygous strain. Ugt2 KO map Tc (UGT2-MAC) strain (Tc: transchromosomic): After introducing UGT2-MAC into rat ES cells (BLK2i-1), chimera rats were produced, which were then crossed with Wistar rats to produce F1 transmission rats, and further crossed with Wistar rats for several generations to produce strain rats. The MAC vector consists of the following genes: HPRT gene full length sequence, bovine growth hormone (BGH) polyA signal, b-actin promoter, b-globin insulator, CMV-IE enhancer, SV40 polyA signal, loxP sequence, FRT sequence, ampicillin resistance gene, neomycin resistance gene, kanamycin resistance gene, puromycin resistance gene, green fluorescent protein (GFP) gene and its mutants, PGK promoter, mouse chromosome 11 centromere region Tc (UGT2-MAC)-UGT2 strain: The strain was created by crossing the Tc(UGT2-MAC) strain with the Ugt2 (cluster) KO strain. National BioResource Project for the Rat in Japan | 625777900 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2025-08-06) | 625777900 | RGD | 2026-09-26 02:42:17 | 0 | |||||
|
WKY-Adcy3em2Mcwi-/- Resource Report Resource Website 1+ mentions |
RRID:RGD_19165364 | Rattus norvegicus | Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 3-bp deletion resulted (rn7: chr6:27,126,062-27,126,064). Contact Dr. Solberg-Woods at Wake Forest University School of Medicine, Email: [email protected] | 19165364 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2026-03-05) | 19165364 | RGD | 2026-09-26 02:42:17 | 1 | |||||
|
Gunn-Ugt1a1j/BluHsd Resource Report Resource Website |
RRID:RGD_1357186 | Rattus norvegicus | This mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life. Harlan | 1357186 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 1357186 | RGD | 2026-09-26 02:41:46 | 0 | |||||
|
BN-Adora2am2Mcwi Resource Report Resource Website |
RRID:RGD_1599757 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q310L mutation is generated from the codon change CAG/CTG of rat Adora2a. | 1599757 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2016-10-24) | 1599757 | RGD | 2026-09-26 02:41:48 | 0 | |||||
|
BN-Has2m1Mcwi Resource Report Resource Website |
RRID:RGD_1599756 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y344Stop mutation is generated from the codon change TAT/TAA. | 1599756 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 1599756 | RGD | 2026-09-26 02:41:48 | 0 | |||||
|
BN-Tgfbr2m1Mcwi Resource Report Resource Website |
RRID:RGD_1579688 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T289M mutation is generated from the codon change ACG/ATG. | 1579688 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 1579688 | RGD | 2026-09-26 02:41:49 | 0 | |||||
|
HOB-Unc5chob/Snk Resource Report Resource Website |
RRID:RGD_1554302 | Rattus norvegicus | Homozygous hobble rats that were taken from the inbred hobble rat colony. National BioResource Project for the Rat in Japan | 1554302 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 1554302 | RGD | 2026-09-26 02:41:48 | 0 | |||||
|
FHH-Klf6m1Mcwi Resource Report Resource Website |
RRID:RGD_1579712 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V135G mutation is generated. | 1579712 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 1579712 | RGD | 2026-09-26 02:41:49 | 0 | |||||
|
BN-Birc3m1Mcwi Resource Report Resource Website |
RRID:RGD_1579681 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.W76G mutation is generated. | 1579681 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2016-10-24) | 1579681 | RGD | 2026-09-26 02:41:49 | 0 | |||||
|
SS-Htr1am2Mcwi Resource Report Resource Website |
RRID:RGD_1599767 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G76R mutation is generated from the codon change GGC/CGC. | 1599767 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 1599767 | RGD | 2026-09-26 02:41:49 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
