Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 3 showing 41 ~ 60 out of 64 results
Snippet view Table view Download 64 Result(s)
Click the to add this resource to a Collection

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631283

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Extinct
Alternate IDs: 631283
Notes: This congenic substrain contains an F344 chromosome 10 segment transferred to a DA background.

Proper citation: RRID:RGD_631283 Copy   


  • RRID:RGD_4139879

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139879

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 4139879
Notes: This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.

Proper citation: RRID:RGD_4139879 Copy   


  • RRID:RGD_68106

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68106

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68106
Notes: NIH, Bethesda, 1964 from a non-inbred (Sprague-Dawley) stock.

Proper citation: RRID:RGD_68106 Copy   


  • RRID:RGD_67939

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=67939

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 67939
Notes: No further information.

Proper citation: RRID:RGD_67939 Copy   


  • RRID:RGD_68187

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68187

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68187
Notes: From a cross between SHR and WKY, with selection for high blood pressureand low spontaneous activity (Hendley et al 1988, Knardahl and Hendley 1990, Hendley and Fan, 1992).

Proper citation: RRID:RGD_68187 Copy   


  • RRID:RGD_68122

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68122

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68122
Notes: Developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London (Sidman and Pearlstein 1965). PETH is a presumed subline.

Proper citation: RRID:RGD_68122 Copy   


  • RRID:RGD_68123

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68123

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68123
Notes: Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). To NIH in 1968 where b x s mating was initiated.

Proper citation: RRID:RGD_68123 Copy   


  • RRID:RGD_68028

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68028

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68028
Notes: Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N).

Proper citation: RRID:RGD_68028 Copy   


  • RRID:RGD_61005

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61005

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 61005
Notes: Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982).

Proper citation: RRID:RGD_61005 Copy   


  • RRID:RGD_68071

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68071

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68071
Notes: Originally designated Le-R and thought to be a mutation within LEW conferring resistance of experimental allergic encephalomyelitis (EAE) (Waxman et al, 1981, Driscoll et al 1985, Gasser et al, 1983). However, it now appears to have been an accidental genetic contamination by BUF/N rats (Goldmuntz et al, 1993),. See LEW, Immunology.

Proper citation: RRID:RGD_68071 Copy   


  • RRID:RGD_68186

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68186

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68186
Notes: From a cross between SHR and WKY with selection for high spontaneous activity and low systolic blood pressure.

Proper citation: RRID:RGD_68186 Copy   


  • RRID:RGD_68062

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68062

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68062
Notes: from a cross between ALB/N and a hooded stock of unknown origin (Hansen et al 1982).

Proper citation: RRID:RGD_68062 Copy   


  • RRID:RGD_68001

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68001

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68001
Notes: This strain has an agouti mutation

Proper citation: RRID:RGD_68001 Copy   


  • RRID:RGD_68027

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68027

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68027
Notes: Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N).

Proper citation: RRID:RGD_68027 Copy   


  • RRID:RGD_68026

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68026

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68026
Notes: Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et al. 1962a, b). Inbred by Iwai and then Hansen (N).

Proper citation: RRID:RGD_68026 Copy   


  • RRID:RGD_68051

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68051

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68051
Notes: Harrington 1962 from a stock selected by CS Hall for low open field defaecation.

Proper citation: RRID:RGD_68051 Copy   


  • RRID:RGD_68171

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68171

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68171
Notes: No further information

Proper citation: RRID:RGD_68171 Copy   


  • RRID:RGD_68172

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68172

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68172
Notes: No further information.

Proper citation: RRID:RGD_68172 Copy   


  • RRID:RGD_68157

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68157

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68157
Notes: Harrington, from stock selected by Tryon for poor maze learning performance (Harrington 1981). Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).

Proper citation: RRID:RGD_68157 Copy   


  • RRID:RGD_631182

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631182

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 631182
Notes: This is maintained in the NIH animal facility of the Inflammatory Joint Diseases Section, Arthritis and Rheumatism Branch, Bethesda MD by brother and sister breeding.

Proper citation: RRID:RGD_631182 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X