Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
HBR1971 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008321 | Caenorhabditis elegans | mihp-2(syb235) V. | Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type.|"Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type.Primers for crossing: Fwd: cgagacttttaaccccgtcgInFwd: aaagcccatgacttgctgaaRev: gctcaggtggttagagggttWild-type bands: 580bp, 2652bp. Mutation band: 335bp."|"Made_by: SunyBiotech Corperation" | WB-STRAIN:WBStrain00008321 | WormBase (WB) | WB | available | WB-STRAIN:HBR1971, CGC_HBR1971 | WormBase | 2026-09-26 11:22:27 | 0 | |||||
|
HS1795 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008501 | Caenorhabditis elegans | dsh-2(or302) mig-5(tm2639)/mIn1 [dpy-10(e128) mIs14] II. | Heterozygotes are WT with pharyngeal GFP. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and few GFP- dsh-2(or302) mig-5(tm2639) homozygotes (Sys). Pick WT GFP+ animals and check for correct segregation of progeny to maintain. | WBGene00001072(dpy-10)|WBGene00001102(dsh-2)|WBGene00003241(mig-5) | WBGene00001072(dpy-10), WBGene00001102(dsh-2), WBGene00003241(mig-5) | WB-STRAIN:WBStrain00008501 | WormBase (WB) | WB | available | WB-STRAIN:HS1795, CGC_HS1795 | WormBase | 2026-09-26 11:22:29 | 0 | |||
|
HS321 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008469 | Caenorhabditis elegans | him-5(e1467) unc-76(e911) V; osEx67. | osEx67 [psa-4::GFP + unc-76(+)]. Maintain by picking non-Unc. Reference: Sawa H, et al. Mol Cell. 2000 Sep;6(3):617-24. | WBGene00001864(him-5)|WBGene00006808(unc-76) | WBGene00001864(him-5), WBGene00006808(unc-76) | WB-STRAIN:WBStrain00008469 | WormBase (WB) | WB | available | WB-STRAIN:HS321, CGC_HS321 | WormBase | 2026-09-26 11:22:29 | 0 | |||
|
HS325 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008470 | Caenorhabditis elegans | him-5(e1467) unc-76(e911) V; osEx71. | osEx71 [psa-1::GFP + unc-76(+)]. Maintain by picking non-Unc. Reference: Sawa H, et al. Mol Cell. 2000 Sep;6(3):617-24. | WBGene00001864(him-5)|WBGene00006808(unc-76) | WBGene00001864(him-5), WBGene00006808(unc-76) | WB-STRAIN:WBStrain00008470 | WormBase (WB) | WB | available | WB-STRAIN:HS325, CGC_HS325 | WormBase | 2026-09-26 11:22:29 | 0 | |||
|
HR1275 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008460 | Caenorhabditis elegans | src-1(cj293) dpy-5(e61) | Heterozygotes are WT and segregate WT, Dpy Mels and dead eggs. | WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00005077(src-1) | WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00005077(src-1) | WB-STRAIN:WBStrain00008460 | WormBase (WB) | WB | available | PMID:38771761 | WB-STRAIN:HR1275, CGC_HR1275 | WormBase | 2026-09-26 11:22:28 | 0 | ||
|
HS144 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008464 | Caenorhabditis elegans | msi-1(os1) III; him-5(e1490) V. | 1.6 kb deletion in msi-1. Males have poor mating efficiency.|"Mutagen:UV/TMP" | WBGene00001864(him-5)|WBGene00003423(msi-1) | WBGene00001864(him-5), WBGene00003423(msi-1) | WB-STRAIN:WBStrain00008464 | WormBase (WB) | WB | available | WB-STRAIN:HS144, CGC_HS144 | WormBase | 2026-09-26 11:22:29 | 0 | |||
|
HS178 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008466 | Caenorhabditis elegans | psa-3(os8) X. | Superficially WT. Defects in asymmetric T cell division causes Psa (phasmid socket absent) phenotype. | WBGene00009560(psa-3) | WBGene00009560(psa-3) | WB-STRAIN:WBStrain00008466 | WormBase (WB) | WB | available | WB-STRAIN:HS178, CGC_HS178 | WormBase | 2026-09-26 11:22:29 | 0 | |||
|
HG284 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00008402 | Caenorhabditis elegans | age-2(yw23) I; age-1(hx546) II. | This double mutant exhibits a doubling of both mean and maximum lifespans at 25C compared to N2. It exhibits a longer lifespan at 25C than it does at 20C. It has somewhat reduced fertility. It has normal development time, appearance, movements and feeding behavior. It's swimming rate in liquid is slightly higher than N2. STS mapping indicates the most likely location for age-2 is on LG I. | WBGene00000090(age-1)|WBGene00000091(age-2) | WBGene00000090(age-1), WBGene00000091(age-2) | WB-STRAIN:WBStrain00008402 | WormBase (WB) | WB | available | PMID:10219000 | WB-STRAIN:HG284, CGC_HG284 | WormBase | 2026-09-26 11:22:28 | 1 | ||
|
HGA8002 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008404 | Caenorhabditis elegans | glp-1(e2141) III; lynEx1. | lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1 alone. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599. | WBGene00001609(glp-1) | WBGene00001609(glp-1) | WB-STRAIN:WBStrain00008404 | WormBase (WB) | WB | available | WB-STRAIN:HGA8002, CGC_HGA8002 | WormBase | 2026-09-26 11:22:28 | 0 | |||
|
HGA8004 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008406 | Caenorhabditis elegans | daf-16(mu86) I; glp-1(e2141) III; lynEx1. | lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of daf-16; glp-1 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599. | WBGene00000912(daf-16)|WBGene00001609(glp-1) | WBGene00000912(daf-16), WBGene00001609(glp-1) | WB-STRAIN:WBStrain00008406 | WormBase (WB) | WB | available | WB-STRAIN:HGA8004, CGC_HGA8004 | WormBase | 2026-09-26 11:22:28 | 0 | |||
|
HGA8005 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008407 | Caenorhabditis elegans | glp-1(e2141) III; daf-12(rh61rh411) X; lynEx1. | lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1; daf-12 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599. | WBGene00000908(daf-12)|WBGene00001609(glp-1) | WBGene00000908(daf-12), WBGene00001609(glp-1) | WB-STRAIN:WBStrain00008407 | WormBase (WB) | WB | available | WB-STRAIN:HGA8005, CGC_HGA8005 | WormBase | 2026-09-26 11:22:28 | 0 | |||
|
HS1337 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008490 | Caenorhabditis elegans | osIs1. | Mutagen:Gamma ray|"osIs1 [CYE-1::GFP (pMF101) + unc-76(+)]; probably integrated on LG II. This strain has Ste, Emb, Muv, Him phenotypes (probably dominant effects of the integration). Expression in many blast cells can be detected. Reference: Fujita et al. PLoS ONE 2, e407 (2007)." | WB-STRAIN:WBStrain00008490 | WormBase (WB) | WB | available | WB-STRAIN:HS1337, CGC_HS1337 | WormBase | 2026-09-26 11:22:29 | 0 | |||||
|
HS1339 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008491 | Caenorhabditis elegans | osIs2. | Mutagen:Gamma ray|"osIs2 [CYE-1::GFP (pMF101) + unc-76(+)]; probably integrated on LG X. No dominant phenotypes observed (see HS1337). Expression in many blast cells can be detected, but much weaker than osIs1. Reference: Fujita et al. PLoS ONE 2, e407 (2007)." | WB-STRAIN:WBStrain00008491 | WormBase (WB) | WB | available | WB-STRAIN:HS1339, CGC_HS1339 | WormBase | 2026-09-26 11:22:29 | 0 | |||||
|
HS1359 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008492 | Caenorhabditis elegans | unc-76(e911) V; osEx233. | osEx233 [scm::mig-5::venus + unc-76(+)]. Pick non-Unc to maintain. Reference: Mizumoto K, Sawa H. Dev Cell. 2007 Feb;12(2):287-99. | WBGene00006808(unc-76) | WBGene00006808(unc-76) | WB-STRAIN:WBStrain00008492 | WormBase (WB) | WB | available | WB-STRAIN:HS1359, CGC_HS1359 | WormBase | 2026-09-26 11:22:29 | 0 | |||
|
HS1673 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008495 | Caenorhabditis elegans | lin-17(n3091) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); vpIs1 X. | vpIs1 [elt-3::GFP + lin-15(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3091 homozygotes (Sys Unc Psa). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308. | WBGene00000254(bli-4)|WBGene00003006(lin-17)|WBGene00003397(mom-5) | WBGene00000254(bli-4), WBGene00003006(lin-17), WBGene00003397(mom-5) | WB-STRAIN:WBStrain00008495 | WormBase (WB) | WB | available | WB-STRAIN:HS1673, CGC_HS1673 | WormBase | 2026-09-26 11:22:29 | 0 | |||
|
HS1675 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008496 | Caenorhabditis elegans | egl-20(n585) cwn-2(ok895) IV. | Egl. Unc. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308. | WBGene00000858(cwn-2)|WBGene00001188(egl-20) | WBGene00000858(cwn-2), WBGene00001188(egl-20) | WB-STRAIN:WBStrain00008496 | WormBase (WB) | WB | available | WB-STRAIN:HS1675, CGC_HS1675 | WormBase | 2026-09-26 11:22:29 | 0 | |||
|
HS1680 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008497 | Caenorhabditis elegans | lin-44(n1792) zdIs5 I; cwn-1(ok546) II; egl-20(n585) cwn-2(ok895) IV/nT1 [qIs51] (IV;V); mom-2(ne874) V/nT1. | zdIs5 [mec-4p::GFP + lin-15(+)] I. Homozygous nT1[qIs51] are inviable. mec-4::GFP is expressed in touch neurons. Heterozygotes are strong Egl Psa GFP+ and segregate dead eggs and non-GFP Unc Egl Psa that give only dead eggs at 25C. | WBGene00000857(cwn-1)|WBGene00000858(cwn-2)|WBGene00001188(egl-20)|WBGene00003029(lin-44)|WBGene00003395(mom-2) | WBGene00000857(cwn-1), WBGene00000858(cwn-2), WBGene00001188(egl-20), WBGene00003029(lin-44), WBGene00003395(mom-2) | WB-STRAIN:WBStrain00008497 | WormBase (WB) | WB | available | WB-STRAIN:HS1680, CGC_HS1680 | WormBase | 2026-09-26 11:22:29 | 0 | |||
|
HGA8009 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008411 | Caenorhabditis elegans | glp-1(e2141) III; fat-5 (tm420) fat-7 (wa36) V. | Sterile at 25C. Maintain at 20C or lower. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599. | WBGene00001397(fat-5)|WBGene00001399(fat-7)|WBGene00001609(glp-1) | WBGene00001397(fat-5), WBGene00001399(fat-7), WBGene00001609(glp-1) | WB-STRAIN:WBStrain00008411 | WormBase (WB) | WB | available | WB-STRAIN:HGA8009, CGC_HGA8009 | WormBase | 2026-09-26 11:22:28 | 0 | |||
|
HS1749 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008499 | Caenorhabditis elegans | mig-1(e1787) lin-17(n671) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Segregates WT GFP+ heterozygotes, non-GFP Unc Sys, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308. | WBGene00000254(bli-4)|WBGene00003006(lin-17)|WBGene00003238(mig-1)|WBGene00003397(mom-5) | WBGene00000254(bli-4), WBGene00003006(lin-17), WBGene00003238(mig-1), WBGene00003397(mom-5) | WB-STRAIN:WBStrain00008499 | WormBase (WB) | WB | available | WB-STRAIN:HS1749, CGC_HS1749 | WormBase | 2026-09-26 11:22:29 | 0 | |||
|
HS732 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008479 | Caenorhabditis elegans | wrm-1(tm514) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm514 homozygotes (probable embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. | WBGene00000254(bli-4)|WBGene00006943(wrm-1) | WBGene00000254(bli-4), WBGene00006943(wrm-1) | WB-STRAIN:WBStrain00008479 | WormBase (WB) | WB | available | WB-STRAIN:HS732, CGC_HS732 | WormBase | 2026-09-26 11:22:29 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
