Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC3192 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037714 | Caenorhabditis elegans | Y50D7A.4(gk3089)/sC1 [dpy-1(s2170)] III. | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y50D7A.4. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk3089 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTATCCGAATTTTCTGCGG. External right primer: ATTTTCAACGGAATTCGACG. Internal left primer: GAAAATTTTGCATTTTCAAGGC. Internal right primer: TCCGCGATTTTTATAGCATTTT. Internal WT amplicon: 940 bp. Deletion size: 647 bp. Deletion left flank: TTTTGTCAAGCCTCAAATCCCACAATTTTG. Deletion right flank: ATAAATGAGCCAAAATTCGTCAAATTCTGT." | WBGene00001063(dpy-1)|WBGene00021754(hpo-29) | WBGene00001063(dpy-1), WBGene00021754(hpo-29) | WB-STRAIN:WBStrain00037714 | WormBase (WB) | WB | available | WB-STRAIN:VC3192, CGC_VC3192 | WormBase | 2026-09-26 11:29:45 | 0 | |||
|
VC3198 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037718 | Caenorhabditis elegans | hip-1(gk3264) III. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T12D8.8. External left primer: GCTGCAGGAATCACTGACAA. External right primer: GAGACGCGAGGAAGAACAAC. Internal left primer: TGGGTCTTCCACCAAAGAAG. Internal right primer: GCGCAAATGCACAGAATATG. Internal WT amplicon: 1339 bp. Deletion size: 689 bp. Deletion left flank: AGCCTTGTGCCGAGTCTGGGTTGATAGAGA. Deletion right flank: GAATTGAAGTGTTTATTCAATTTGTTTGGA. Validation: gk3264 passed by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011735(hip-1) | WBGene00011735(hip-1) | WB-STRAIN:WBStrain00037718 | WormBase (WB) | WB | available | WB-STRAIN:VC3198, CGC_VC3198 | WormBase | 2026-09-26 11:29:45 | 0 | |||
|
VC3199 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037719 | Caenorhabditis elegans | tbx-33(gk3098) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y66A7A.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3098 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATATTGAAAACTAGGAACTTGGCG. External right primer: CCTACCAGAATCAGTATGCACATC. Internal left primer: CTGAATTTGTTCCATTGTTAGAAAGA. Internal right primer: CTTAAAGTCAAAAACAAACGTTCAAA. Internal WT amplicon: 1543 bp. Deletion size: 474 bp. Deletion left flank: AGGATTAGGCATAGGTTTAGGCTTAGGGTT. Deletion right flank: TTGTAGTTGGATTCTGGATTGAGATGCTCG. Insertion Sequence: GGGCTTAGGATAAAGCTTTGGCTCACGCTTAGGTTTAGGATTAGGTATAGGTTTAGGCT TAGGGTTAGGCTTAGGGTTAGGCTTAGGC."|"Y66A7A.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3098 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATATTGAAAACTAGGAACTTGGCG. External right primer: CCTACCAGAATCAGTATGCACATC. Internal left primer: CTGAATTTGTTCCATTGTTAGAAAGA. Internal right primer: CTTAAAGTCAAAAACAAACGTTCAAA. Internal WT amplicon: 1543 bp. Deletion size: 474 bp. Deletion left flank: AGGATTAGGCATAGGTTTAGGCTTAGGGTT. Deletion right flank: TTGTAGTTGGATTCTGGATTGAGATGCTCG. Insertion Sequence: GGGCTTAGGATAAAGCTTTGGCTCACGCTTAGGTTTAGGATTAGGTATAGGTTTAGGCTTAGGGTTAGGCTTAGGGTTAGGCTTAGGC." | WBGene00000254(bli-4)|WBGene00006552(tbx-33) | WBGene00000254(bli-4), WBGene00006552(tbx-33) | WB-STRAIN:WBStrain00037719 | WormBase (WB) | WB | available | WB-STRAIN:VC3199, CGC_VC3199 | WormBase | 2026-09-26 11:29:45 | 0 | |||
|
VC3556 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037798 | Caenorhabditis elegans | nas-25(ok3756) II. | F46C5.3. External left primer: GGATCATGCTCATCTCCGAT. External right primer: CGGTTTCTTGCTTCATCCTC. Internal left primer: GACGCCAACAAATTGGAACT. Internal right primer: ATTTGAAACAAAGAAGGCGG. Internal WT amplicon: 1158 bp. Deletion size: 651 bp. Deletion left flank: AAGTGTTATGCATTATTCAGCTGATTCGTA. Deletion right flank: CTCCATTAAATCTAACAACTACTGTTAATC.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003544(nas-25) | WBGene00003544(nas-25) | WB-STRAIN:WBStrain00037798 | WormBase (WB) | WB | available | WB-STRAIN:VC3556, CGC_VC3556 | WormBase | 2026-09-26 11:29:46 | 0 | |||
|
VC3183 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037711 | Caenorhabditis elegans | F45H11(gk3128) I. | F45H11. External left primer: CGCGATGAGACCCATCTATT. External right primer: CGACAATGTGGTCGTTTTTG. Internal left primer: CTTGTGTCGATTTACGGGCT. Internal right primer: ATGGAAGAGTGCAAGTTCGG. Internal WT amplicon: 1685 bp. Deletion size: 107 bp. Deletion left flank: GAGAGACGCAGCAGCTTACTACGCAGTTAT. Deletion right flank: AAATATATTATTGAGAAAAGAAGAAGAAAA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00037711 | WormBase (WB) | WB | available | WB-STRAIN:VC3183, CGC_VC3183 | WormBase | 2026-09-26 11:29:45 | 0 | |||||
|
VC3297 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037769 | Caenorhabditis elegans | gkDf44 IV; T04F3.1(gk3282) C14C10.4(gk3281) V. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk3281) in C14C10.4, detectable by PCR using the following primers. External left primer: TAACTCATTAACGTCGGTGGC. External right primer: TGTGTAATTACCGTACCCGGA. Internal left primer: CATCAGATCAAGGGCTGGTAA. Internal right primer: GGGTTAAGTAGAAACGGCCTG. Internal WT amplicon: 1785 bp. Deletion size: 540 bp. Deletion left flank: GCGTTTCTCTTGTTGATGGAGCAAACATAA. Deletion right flank: AGATTAAAAGCATCAAATTGTCCATTTTCA. Insertion Sequence: ATTTTGCAAAC. Validation: gk3281 passed by CGH. Other deletions (gkDf44, gk3282) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00007587(mma-1)|WBGene00011436(T04F3.1) | WBGene00007587(mma-1), WBGene00011436(T04F3.1) | WB-STRAIN:WBStrain00037769 | WormBase (WB) | WB | available | WB-STRAIN:VC3297, CGC_VC3297 | WormBase | 2026-09-26 11:29:46 | 0 | |||
|
VC3278 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037761 | Caenorhabditis elegans | dhs-22(gk3197) gkDf30 V. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk3197) in C15H11.4, detectable by PCR using the following primers. External left primer: AATGTCCTCATTCAGACGGC. External right primer: TTGACCCCGCTGGATACTAC. Internal left primer: CCGAGAAGGAGAAACTGACG. Internal right primer: GCCATTGAGGCTCTTCAGAC. Internal WT amplicon: 1991 bp. Deletion size: 1301 bp. Deletion left flank: AATAGAGAAATTATTGTAGCTGCGCTGGCA. Deletion right flank: ACTAAAAAATAAATAACAGGGATTGCGAAA. Validation: gk3197 passed by CGH. Other deletion (gkDf30) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000985(dhs-22) | WBGene00000985(dhs-22) | WB-STRAIN:WBStrain00037761 | WormBase (WB) | WB | available | WB-STRAIN:VC3278, CGC_VC3278 | WormBase | 2026-09-26 11:29:46 | 0 | |||
|
VC3279 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037762 | Caenorhabditis elegans | C01B12.2(gk3198) II. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk3198) in C01B12.2, detectable by PCR using the following primers. External left primer: TCAAAAATTTGCGAAACGTG. External right primer: AGGGAGTGAGCGAGAAACAA. Internal left primer: CTACATTGGTCCGACCCCTA. Internal right primer: ATGAGCTTTGCCCTGAAAGA. Internal WT amplicon: 1379 bp. Deletion size: 941 bp. Deletion left flank: AAGTTAAGCAATTTACTCAAATTATTTCAG. Deletion right flank: TGAATTTCGCAATAAAACTTTTTGGAAATT. Insertion Sequence: ATTTTT. Validation: gk3198 passed by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00015285(gmeb-1) | WBGene00015285(gmeb-1) | WB-STRAIN:WBStrain00037762 | WormBase (WB) | WB | available | WB-STRAIN:VC3279, CGC_VC3279 | WormBase | 2026-09-26 11:29:46 | 0 | |||
|
VC3287 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037767 | Caenorhabditis elegans | C08G9.2(gk3384)/nT1 IV; +/nT1 V. | C08G9.2. Apparent homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and gk3384 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACAAGTTGGTACTGGGAGG. External right primer: CCATGCGAATTTTTGAACTGT. Internal left primer: ACAAGACCGTATGGGCAAAG. Internal right primer: ACCAATTTCATCTTGCCCTG. Internal WT amplicon: 1980 bp. Deletion size: 466 bp. Deletion left flank: GTCTGATCGTAGTTTCCATTTCTACTGCAT. Deletion right flank: GGTTTGATGTACATTCTACACGTCGAAGTG. Insertion Sequence: TTCTACT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00015620(C08G9.2) | WBGene00015620(C08G9.2) | WB-STRAIN:WBStrain00037767 | WormBase (WB) | WB | available | WB-STRAIN:VC3287, CGC_VC3287 | WormBase | 2026-09-26 11:29:46 | 0 | |||
|
VC3566 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037800 | Caenorhabditis elegans | clpf-1(ok3753)/qC1[dpy-19(e1259) glp-1(q339)] III. | F59A2.4. Deletion balanced by glp-1 and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3753 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAACACCAATGGATTTGGC. External right primer: CCAGGCTTGCAAATAAGCTC. Internal left primer: AAAGTCAATTTCGGCCCATT. Internal right primer: TTGAGGACAAAACCTACCCG. Internal WT amplicon: 1279 bp. Deletion size: 698 bp. Deletion left flank: CCGAGAGCGCATACGTTGCCGAGAGCACTC. Deletion right flank: AAATCTATCTCTCTACGAAGCATTGTTCAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00010304(clpf-1) | WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00010304(clpf-1) | WB-STRAIN:WBStrain00037800 | WormBase (WB) | WB | available | WB-STRAIN:VC3566, CGC_VC3566 | WormBase | 2026-09-26 11:29:46 | 0 | |||
|
VC3567 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037801 | Caenorhabditis elegans | lam-3(ok2030)/hT2 I; +/hT2[bli-4(e937)] III. | T22A3.8. Homozygous lethal deletion balanced with bli-4-marked balancer. Heterozygotes are WT and segregate WT, Bli-4 hT2 homozygotes, hT2 aneuploids (arrested embryos), and ok2030 homozygotes (arrest stage/phenotype undetermined). hT2 homozygotes do not blister until the adult, and may be very difficult to tell from WT. Pick WT and check for correct segregation of progeny to maintain. External left primer: GGAGGTCGTAGATGCGAGAG. External right primer: TTCTCAACTCCGATCGCTTT. Internal left primer: TATCGGCTTCCAATCCTTTG. Internal right primer: GCTTTCGGGTAAGTGTGAGC. Internal WT amplicon: 3097 bp. Deletion size: 1499 bp. Deletion left flank: GTAAACCAGGACACGTCGGAAATCCATCTC. Deletion right flank: TGGTTCCAATATGAACCGAAAAATTTACTG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00002248(lam-3) | WBGene00000254(bli-4), WBGene00002248(lam-3) | WB-STRAIN:WBStrain00037801 | WormBase (WB) | WB | available | WB-STRAIN:VC3567, CGC_VC3567 | WormBase | 2026-09-26 11:29:46 | 0 | |||
|
VC3282 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037765 | Caenorhabditis elegans | slr-2(gk3199) V. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk3199) in Y59A8B.13, detectable by PCR using the following primers. External left primer: ATTCGCTGGAAACTTGGAAAT. External right primer: AAATGGCTGAAAAGCCAAAAT. Internal left primer: ACCTCTGAAATCCACCGAAAT. Internal right primer: GAAAACGCTGAAAATGTTGGA. Internal WT amplicon: 1267 bp. Deletion size: 193 bp. Deletion left flank: TTTTTTTTCTATTTTTGGCGGGAAACTGAA. Deletion right flank: TATGAAAATTGTCGAAAAATTTCCACATTT. Validation: No CGH probes for gk3199."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00013350(slr-2) | WBGene00013350(slr-2) | WB-STRAIN:WBStrain00037765 | WormBase (WB) | WB | available | WB-STRAIN:VC3282, CGC_VC3282 | WormBase | 2026-09-26 11:29:46 | 0 | |||
|
VC3310 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037770 | Caenorhabditis elegans | srgp-1(gk3385)/nT1 IV; +/nT1 V. | F12F6.5. Apparent homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and gk3385 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAGTCACTTGAAGCATCAGAAAA. External right primer: TCAGAATCAAGCTTCTTTGTTGAG. Internal left primer: TCAAAAACCAATTTCGTTAGAGC. Internal right primer: TGATTTTTATTGCCTTTTTCCAA. Internal WT amplicon: 2179 bp. Deletion size: 980 bp. Deletion left flank: TATGTAGAAGCAACTGGAGAAGAAATTCCA. Deletion right flank: TTCAAAAATAGTTCATTATCATCCGAAGGA. Insertion Sequence: TAG.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006406(srgp-1) | WBGene00006406(srgp-1) | WB-STRAIN:WBStrain00037770 | WormBase (WB) | WB | available | WB-STRAIN:VC3310, CGC_VC3310 | WormBase | 2026-09-26 11:29:46 | 0 | |||
|
VC3365 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037775 | Caenorhabditis elegans | pygo-1(gk3509) IV/nT1 [qIs51] (IV;V). | C02B10.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3509 homozygotes (sterile, eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAATCCACAGAACCG. External right primer: TTGCGGTAGCTTAGGCAGAT. Internal left primer: CCTGAGTCATCTCCTGCACA. Internal right primer: AGAGCGGGATCTGGAAAAAT. WT internal amplicon: 2056 bp. Deletion size: approximately 600 bp.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00015330(pygo-1) | WBGene00015330(pygo-1) | WB-STRAIN:WBStrain00037775 | WormBase (WB) | WB | available | WB-STRAIN:VC3365, CGC_VC3365 | WormBase | 2026-09-26 11:29:46 | 0 | |||
|
VC3327 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037772 | Caenorhabditis elegans | W03F9.1(gk3315) V/nT1 [qIs51] (IV;V). | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W03F9.1. Homozygous lethal or sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3315 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACAACGAACAACCGAGG. External right primer: GCGAAGAAGATGTAGGCGTC. Internal left primer: ATCGGTTTCTCGAGTCCTCC. Internal right primer: AACGAGATTCAAAGCGGAGA. Internal WT amplicon: 2151 bp. Deletion size: 836 bp. Deletion left flank: ACTTCCAGATCAATCTCAGGGATCGACAGA. Deletion right flank: CACTTGTGAATTGCTTAATAATCTGCAAAA. Insertion Sequence: A." | WBGene00020999(W03F9.1) | WBGene00020999(W03F9.1) | WB-STRAIN:WBStrain00037772 | WormBase (WB) | WB | available | WB-STRAIN:VC3327, CGC_VC3327 | WormBase | 2026-09-26 11:29:46 | 0 | |||
|
VC3371 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037778 | Caenorhabditis elegans | eat-6(ok1320) V/nT1 [qIs51] (IV;V). | B0365.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1320 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATCGGAATGAGATGGGAAA. External right primer: ACCTCAAGCAGGAGGTCAAA. Internal left primer: CGAATCAAGAAACGACGGAT. Internal right primer: CAAGAACGGACCAAATGCTT. Internal WT amplicon: 2957 bp. Deletion size: 780 bp. Deletion left flank: AAATTTATAATGAGATTTAATTGTCTTCTT. Deletion right flank: GACACATCAGATCCAGCAATACCCATAGCA. Insertion Sequence: GAAAAAAACC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001137(eat-6) | WBGene00001137(eat-6) | WB-STRAIN:WBStrain00037778 | WormBase (WB) | WB | available | PMID:27936181 | WB-STRAIN:VC3371, CGC_VC3371 | WormBase | 2026-09-26 11:29:46 | 0 | ||
|
VC3372 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037779 | Caenorhabditis elegans | mrpl-47(ok1340) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). | B0261-4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1340 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCAAGCTTTTGCACCTCCT. External right primer: TGTGGCTGCTTTGTTCTGTC. Internal left primer: CTGGAGTTTTGCGGACTTTC. Internal right primer: TCTGCCGATTTAGTGCATTG. Internal WT amplicon: 2114 bp. Deletion size: 620 bp. Deletion left flank: AAATTTAAATTTAAGGTATGTGTGCTTGAA. Deletion right flank: CCATTGTTCTTTTTTCTTGATATTTTGAAA.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00015092(mrpl-47) | WBGene00000254(bli-4), WBGene00015092(mrpl-47) | WB-STRAIN:WBStrain00037779 | WormBase (WB) | WB | available | WB-STRAIN:VC3372, CGC_VC3372 | WormBase | 2026-09-26 11:29:46 | 0 | |||
|
VC3366 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037776 | Caenorhabditis elegans | Y62E10A.10(gk3369) IV/nT1 [qIs51] (IV;V). | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y62E10A.10. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3369 homozygotes (sterile, flaccid). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATCTTTAAAGGCGCAGACGA. External right primer: GCAATGTGAACGTGGACAAC. Internal left primer: CACATTGACTTGATGGCTGG. Internal right primer: CCGATTTATTACTCGACCCG. Internal WT amplicon: 1660 bp. Deletion size: 617 bp. Deletion left flank: AGAGTGATTTTTTTTTAGACAAAAAAATTT. Deletion right flank: CCAGTTCCACCTGCAAGTATTTGTGGTTAT." | WBGene00013378(emc-3) | WBGene00013378(emc-3) | WB-STRAIN:WBStrain00037776 | WormBase (WB) | WB | available | WB-STRAIN:VC3366, CGC_VC3366 | WormBase | 2026-09-26 11:29:46 | 0 | |||
|
VC3391 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037781 | Caenorhabditis elegans | R06F6.8(ok1318)/mIn1 [mIs14 dpy-10(e128)] II. | Mutagen:UV/TMP|"R06F6.8. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1318 homozygotes (sterile, lays unfertilized oocytes and very few fertilized eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGCGATAAACGTCATTTCCT. External right primer: AACGTTTTTGCGTTCCAAAT. Internal left primer: TTGATTCCTTTTGCACCACA. Internal right primer: CTTCCGAAGCATGAAAAGGA. Internal WT amplicon: 3207 bp. Deletion size: 1673 bp. Deletion left flank: CAACCGACGCATATCGACTGTCAAGTCTCT. Deletion right flank: TTAATTCTCCACGTGTTTCTTTGAAATTGG."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00011071(R06F6.8) | WBGene00001072(dpy-10), WBGene00011071(R06F6.8) | WB-STRAIN:WBStrain00037781 | WormBase (WB) | WB | available | WB-STRAIN:VC3391, CGC_VC3391 | WormBase | 2026-09-26 11:29:46 | 1 | |||
|
VC3434 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037782 | Caenorhabditis elegans | pot-1(ok1292) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). | B0280.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1292 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTTCCGGTCTTCGTCTAC. External right primer: ACTTTCAGCTCCAGACGCTC. Internal left primer: CGCAGCAACATCATTCAAAC. Internal right primer: ATAGATTGAGCGCCGAGAAG. Internal WT amplicon: 2359 bp. Deletion size: 916 bp. Deletion left flank: CTCATCAAGTTGATCAGTTTGCTGAGTTCA. Deletion right flank: CCTGAATATTTTTTTTGAATCTAGTAACTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00015105(pot-1) | WBGene00000254(bli-4), WBGene00015105(pot-1) | WB-STRAIN:WBStrain00037782 | WormBase (WB) | WB | available | WB-STRAIN:VC3434, CGC_VC3434 | WormBase | 2026-09-26 11:29:46 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.