Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00008311
Source Database: WormBase (WB)
Affected Genes: WBGene00001454(flp-11)
Genomic Alteration: WBGene00001454(flp-11)
Availability: available
Source References: PMID:36652499, PMID:37155851
Synonyms: flp-11(tm2706) X.
Alternate IDs: WB-STRAIN:HBR507, CGC_HBR507
Notes: 70% reduction of behavioral quiescence during sleep. Reference: Turek et al. eLife 2016;5:e12499.
Proper citation: RRID:WB-STRAIN:WBStrain00008311 Copy
http://www.wormbase.org/db/get?name=WBStrain00008312
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: goeIs102.
Alternate IDs: WB-STRAIN:HBR546, CGC_HBR546
Notes: goeIs102 [aptf-1 5'UTR::ChR2::mKate2::aptf-1 3'UTR + unc-119(+)]. Superficially wild-type. This strain carries an optogenetic transgene that can be used to send worms to sleep immediately at any given time point. Reference: Turek M, et al. Curr Biol. 2013 Nov 18;23(22):2215-2223.|"goeIs102 [aptf-1 5'UTR::ChR2::mKate2::aptf-1 3'UTR + unc-119(+)]. Superficially wild-type. This strain carries an optogenetic transgene, which allows to send worms to sleep immediately at any given time point. Reference: Turek M, et al. Curr Biol. 2013 Nov 18;23(22):2215-2223."
Proper citation: RRID:WB-STRAIN:WBStrain00008312 Copy
http://www.wormbase.org/db/get?name=WBStrain00008313
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: C10C6.7(goe3) IV.
Alternate IDs: WB-STRAIN:HBR762, CGC_HBR762
Notes: goe3 is a 25 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.|"Made_by: Lewandrowski & Turek"
Proper citation: RRID:WB-STRAIN:WBStrain00008313 Copy
http://www.wormbase.org/db/get?name=WBStrain00008383
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: hwSi3 II; unc-119(ed9) III.
Alternate IDs: WB-STRAIN:HCC21, CGC_HCC21
Notes: hwSi3 [pie-1p::GFP::mex-3::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing full-length MEX-3 uniformly throughout oocytes and early embryos through the 4-cell stage. GFP::MEX-3 then mirrors endogenous MEX-3, disappearing from somatic cells by about the 12-cell stage. Also detected in P granules. GFP::MEX-3 can replace endogenous MEX-3. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.
Proper citation: RRID:WB-STRAIN:WBStrain00008383 Copy
http://www.wormbase.org/db/get?name=WBStrain00008386
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:33440146, PMID:37453426
Synonyms: unc-119(ed3) III; uocIs1.
Alternate IDs: WB-STRAIN:HCL67, CGC_HCL67
Notes: uocIs1 [eft-3p::Cas9(dpiRNA)::tbb-2 3' UTR + unc-119(+)]. Cas9 is optimized to remove all piRNA sites. Cas9 is expressed in the germline. Reference: Zhang D, et al. Science. 2018 Feb 2;359(6375):587-592.
Proper citation: RRID:WB-STRAIN:WBStrain00008386 Copy
http://www.wormbase.org/db/get?name=WBStrain00008389
Source Database: WormBase (WB)
Affected Genes: WBGene00004879(smg-1)|WBGene00006826(unc-97)
Genomic Alteration: WBGene00004879(smg-1), WBGene00006826(unc-97)
Availability: available
Source References: PMID:7348600
Synonyms: smg-1(re1) I; unc-97(su110) X.
Alternate IDs: WB-STRAIN:HE110, CGC_HE110
Notes: Variable phenotype-WT when relaxed. Paralyzed. Dave Reiner identified smg-1(re1) in this strain.
Proper citation: RRID:WB-STRAIN:WBStrain00008389 Copy
http://www.wormbase.org/db/get?name=WBStrain00008334
Source Database: WormBase (WB)
Affected Genes: WBGene00004796(sid-2)
Genomic Alteration: WBGene00004796(sid-2)
Availability: available
Source References: PMID:38547071
Synonyms: ccIs4251 [(pSAK2) Pmyo-3::GFP::LacZ::NLS + (pSAK4) Pmyo-3::mitochondrial GFP + dpy-20(+)] I; qtIs3 [Pmyo-2::GFP dsRNA hairpin] sid-2(qt42) III; mIs11 [Pmyo-2::GFP + Ppes-10::GFP + gut-promoter::GFP] IV
Alternate IDs: WB-STRAIN:HC271, CGC_HC271
Notes: ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. qtIs3 [myo-2p::GFP dsRNA hairpin]. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Resistant to systemic RNAi by feeding only.
Proper citation: RRID:WB-STRAIN:WBStrain00008334 Copy
http://www.wormbase.org/db/get?name=WBStrain00008314
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: C10C6.7(goe5) IV.
Alternate IDs: WB-STRAIN:HBR764, CGC_HBR764
Notes: goe5 is a 4 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.|"Made_by: Lewandrowski & Turek"
Proper citation: RRID:WB-STRAIN:WBStrain00008314 Copy
http://www.wormbase.org/db/get?name=WBStrain00008315
Source Database: WormBase (WB)
Affected Genes: WBGene00002988(lim-6)
Genomic Alteration: WBGene00002988(lim-6)
Availability: available
Source References: EMPTY
Synonyms: lim-6(tm4836) X.
Alternate IDs: WB-STRAIN:HBR914, CGC_HBR914
Notes: Complete lack of behavioral quiescence during sleep. Reference: Turek et al. eLife 2016;5:e12499.
Proper citation: RRID:WB-STRAIN:WBStrain00008315 Copy
http://www.wormbase.org/db/get?name=WBStrain00008316
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; goeEx361.
Alternate IDs: WB-STRAIN:HBR986, CGC_HBR986
Notes: goeEx361 [ceh-24p::ReaChr::mKate2::unc-54 3'UTR + unc-119(+)]. Pick non-Unc to maintain. Reporter expresses ReaChr with expression control mKate2. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846.
Proper citation: RRID:WB-STRAIN:WBStrain00008316 Copy
http://www.wormbase.org/db/get?name=WBStrain00008319
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: goeIs247.
Alternate IDs: WB-STRAIN:HBR1077, CGC_HBR1077
Notes: goeIs247 [ceh-24p::GCaMP6s::mKate2::unc-54 3'UTR + unc-119(+)]. Reporter expresses calcium sensor GCaMP6s with expression control mKate2. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846.
Proper citation: RRID:WB-STRAIN:WBStrain00008319 Copy
http://www.wormbase.org/db/get?name=WBStrain00008320
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: goeIs288.
Alternate IDs: WB-STRAIN:HBR1261, CGC_HBR1261
Notes: goeIs288 [flp-11p::mKate2::unc-54 3'UTR + unc-119(+)]. Low copy number insertion. Integration site unknown, but likely not in LG II. Reference: Turek et al. eLife 2016;5:e12499.
Proper citation: RRID:WB-STRAIN:WBStrain00008320 Copy
http://www.wormbase.org/db/get?name=WBStrain00008321
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: mihp-2(syb235) V.
Alternate IDs: WB-STRAIN:HBR1971, CGC_HBR1971
Notes: Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type.|"Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type.Primers for crossing: Fwd: cgagacttttaaccccgtcgInFwd: aaagcccatgacttgctgaaRev: gctcaggtggttagagggttWild-type bands: 580bp, 2652bp. Mutation band: 335bp."|"Made_by: SunyBiotech Corperation"
Proper citation: RRID:WB-STRAIN:WBStrain00008321 Copy
http://www.wormbase.org/db/get?name=WBStrain00008501
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001102(dsh-2)|WBGene00003241(mig-5)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001102(dsh-2), WBGene00003241(mig-5)
Availability: available
Source References: EMPTY
Synonyms: dsh-2(or302) mig-5(tm2639)/mIn1 [dpy-10(e128) mIs14] II.
Alternate IDs: WB-STRAIN:HS1795, CGC_HS1795
Notes: Heterozygotes are WT with pharyngeal GFP. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and few GFP- dsh-2(or302) mig-5(tm2639) homozygotes (Sys). Pick WT GFP+ animals and check for correct segregation of progeny to maintain.
Proper citation: RRID:WB-STRAIN:WBStrain00008501 Copy
http://www.wormbase.org/db/get?name=WBStrain00008469
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00006808(unc-76)
Genomic Alteration: WBGene00001864(him-5), WBGene00006808(unc-76)
Availability: available
Source References: EMPTY
Synonyms: him-5(e1467) unc-76(e911) V; osEx67.
Alternate IDs: WB-STRAIN:HS321, CGC_HS321
Notes: osEx67 [psa-4::GFP + unc-76(+)]. Maintain by picking non-Unc. Reference: Sawa H, et al. Mol Cell. 2000 Sep;6(3):617-24.
Proper citation: RRID:WB-STRAIN:WBStrain00008469 Copy
http://www.wormbase.org/db/get?name=WBStrain00008470
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00006808(unc-76)
Genomic Alteration: WBGene00001864(him-5), WBGene00006808(unc-76)
Availability: available
Source References: EMPTY
Synonyms: him-5(e1467) unc-76(e911) V; osEx71.
Alternate IDs: WB-STRAIN:HS325, CGC_HS325
Notes: osEx71 [psa-1::GFP + unc-76(+)]. Maintain by picking non-Unc. Reference: Sawa H, et al. Mol Cell. 2000 Sep;6(3):617-24.
Proper citation: RRID:WB-STRAIN:WBStrain00008470 Copy
http://www.wormbase.org/db/get?name=WBStrain00008460
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00005077(src-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00005077(src-1)
Availability: available
Source References: PMID:38771761
Synonyms: src-1(cj293) dpy-5(e61)
Alternate IDs: WB-STRAIN:HR1275, CGC_HR1275
Notes: Heterozygotes are WT and segregate WT, Dpy Mels and dead eggs.
Proper citation: RRID:WB-STRAIN:WBStrain00008460 Copy
http://www.wormbase.org/db/get?name=WBStrain00008464
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00003423(msi-1)
Genomic Alteration: WBGene00001864(him-5), WBGene00003423(msi-1)
Availability: available
Source References: EMPTY
Synonyms: msi-1(os1) III; him-5(e1490) V.
Alternate IDs: WB-STRAIN:HS144, CGC_HS144
Notes: 1.6 kb deletion in msi-1. Males have poor mating efficiency.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00008464 Copy
http://www.wormbase.org/db/get?name=WBStrain00008466
Source Database: WormBase (WB)
Affected Genes: WBGene00009560(psa-3)
Genomic Alteration: WBGene00009560(psa-3)
Availability: available
Source References: EMPTY
Synonyms: psa-3(os8) X.
Alternate IDs: WB-STRAIN:HS178, CGC_HS178
Notes: Superficially WT. Defects in asymmetric T cell division causes Psa (phasmid socket absent) phenotype.
Proper citation: RRID:WB-STRAIN:WBStrain00008466 Copy
http://www.wormbase.org/db/get?name=WBStrain00008402
Source Database: WormBase (WB)
Affected Genes: WBGene00000090(age-1)|WBGene00000091(age-2)
Genomic Alteration: WBGene00000090(age-1), WBGene00000091(age-2)
Availability: available
Source References: PMID:10219000
Synonyms: age-2(yw23) I; age-1(hx546) II.
Alternate IDs: WB-STRAIN:HG284, CGC_HG284
Notes: This double mutant exhibits a doubling of both mean and maximum lifespans at 25C compared to N2. It exhibits a longer lifespan at 25C than it does at 20C. It has somewhat reduced fertility. It has normal development time, appearance, movements and feeding behavior. It's swimming rate in liquid is slightly higher than N2. STS mapping indicates the most likely location for age-2 is on LG I.
Proper citation: RRID:WB-STRAIN:WBStrain00008402 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
