Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
BN-Lx Resource Report Resource Website |
RRID:RGD_61113 | Rattus norvegicus | These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background. | 61113 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 61113 | RGD | 2026-09-26 02:41:39 | 0 | |||||
|
WI-Foxn1em1Nips Resource Report Resource Website 1+ mentions |
RRID:RGD_10053598 | Rattus norvegicus | Foxn1 mutation was induced by injecting pX330 expressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97). Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN | 10053598 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10053598 | RGD | 2026-09-26 02:41:39 | 1 | |||||
|
SD-Fusem1Ionsz Resource Report Resource Website |
RRID:RGD_10047085 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat. The mutation changed the 521th amino acid Arg (R) into Cys (C). Institute of Neuroscience, Chinese Academy of Sciences | 10047085 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10047085 | RGD | 2026-09-26 02:41:39 | 0 | |||||
|
LEW-Chrna5em1Mcwi Resource Report Resource Website |
RRID:RGD_10054386 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Chrna5 gene of LEW/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the Chrna5 gene. Contact MCW rat distribution at [email protected] | 10054386 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-11-26) | 10054386 | RGD | 2026-09-26 02:41:40 | 0 | |||||
|
LEW-Chrna4em3Mcwi Resource Report Resource Website |
RRID:RGD_10054383 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/NCrl rat embryos. The resulting mutation is a 16-bp deletion in the Chrna4 gene. Contact MCW rat distribution at [email protected] | 10054383 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-11-26) | 10054383 | RGD | 2026-09-26 02:41:40 | 0 | |||||
|
DA-Glaem2Mcwi Resource Report Resource Website |
RRID:RGD_10054398 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Gla gene of DA/OlaHsd rat embryos. The resulting mutation is a 47-bp deletion in the Gla gene. Contact MCW rat distribution at [email protected] | 10054398 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2018-10-22) | 10054398 | RGD | 2026-09-26 02:41:40 | 0 | |||||
|
FHH-Chr 3BN-Helz2em3Mcwi Resource Report Resource Website |
RRID:RGD_10054401 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Helz2 gene of FHH-Chr 3BN/Mcwi rat embryos.The resulting mutation is a 11-bp deletion in the Helz2 gene. Contact MCW rat distribution at [email protected] | 10054401 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2018-10-22) | 10054401 | RGD | 2026-09-26 02:41:40 | 0 | |||||
|
LEW-Chrna3em9Mcwi Resource Report Resource Website |
RRID:RGD_10054376 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos. The resulting mutation is a 17-bp deletion in the Chrna3 gene. Contact MCW rat distribution at [email protected] | 10054376 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-11-26) | 10054376 | RGD | 2026-09-26 02:41:40 | 0 | |||||
|
SS-Arhgef11em5Mcwi Resource Report Resource Website |
RRID:RGD_10054296 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Arhgef11 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in the Arhgef11 gene. Contact MCW rat distribution at [email protected] | 10054296 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-22) | 10054296 | RGD | 2026-09-26 02:41:40 | 0 | |||||
|
SS-Sirt3em4Mcwi Resource Report Resource Website |
RRID:RGD_10054453 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Sirt3 gene. Contact MCW rat distribution at [email protected] | 10054453 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 10054453 | RGD | 2026-09-26 02:41:40 | 0 | |||||
|
T2DN-Sirt3em35Mcwi Resource Report Resource Website |
RRID:RGD_10054456 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of T2DN/Mcwi rat embryos. The resulting mutation is a 82-bp deletion of exon 3 in the Sirt3 gene. Contact MCW rat distribution at [email protected] | 10054456 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-22) | 10054456 | RGD | 2026-09-26 02:41:40 | 0 | |||||
|
SS-Sirt3em25Mcwi Resource Report Resource Website |
RRID:RGD_10054450 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in the Sirt3 gene. Contact MCW rat distribution at [email protected] | 10054450 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-22) | 10054450 | RGD | 2026-09-26 02:41:40 | 0 | |||||
|
SD-Il2rgem2Mcwi Resource Report Resource Website |
RRID:RGD_10002794 | Rattus norvegicus | This strain was produced by injecting TALENs targeting the sequence CTTAGACAACTCTCAATAGCTttatgggcctcggccAAGCGGCATGGAAGGAGGC into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 2. | 10002794 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 10002794 | RGD | 2026-09-26 02:41:41 | 0 | |||||
|
F344-Tasp1Tn(sb-T2/Bart3)2.219Mcwi Resource Report Resource Website |
RRID:RGD_2299122 | Rattus norvegicus | These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tasp1 gene. | 2299122 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 2299122 | RGD | 2026-09-26 02:41:41 | 0 | |||||
|
LETsc2Eker/Hin Resource Report Resource Website 1+ mentions |
RRID:RGD_625624 | Rattus norvegicus | Eker rat is derived from the Long-Evans strain that has a mutation in Tsc2 gene. Originally reported by R. Eker in 1954 at the Norwegian Radium Hospital, Oslo. | 625624 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 625624 | RGD | 2026-09-26 02:41:43 | 2 | |||||
|
SPRD-Anks6PKD/Fsn Resource Report Resource Website |
RRID:RGD_10043617 | Rattus norvegicus | This strain rats was provided to University of Kansas from Central Institute for Laboratory Animal Breeding (Hanover, Germany), and then was introduced to Fujita Health University. National BioResource Project for the Rat in Japan | 10043617 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-04-20) | 10043617 | RGD | 2026-09-26 02:41:43 | 0 | |||||
|
SHR/Kyo Resource Report Resource Website |
RRID:RGD_1302620 | Rattus norvegicus | Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). National BioResource Project for the Rat in Japan | 1302620 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-11-12) | 1302620 | RGD | 2026-09-26 02:41:44 | 0 | |||||
|
SD-Aif1tm(EGFP)Apps/Mmmc Resource Report Resource Website |
RRID:RGD_152999023 | Rattus norvegicus | Applied StemCell, Inc (Milpitas, CA) was contracted to generate the Iba1-EGFP knock-in rat model using CRISPR/Cas9 technology in the Sprague Dawley rat strain. The donor construct inserted consisted of the EGFP coding sequence (minus the first ATG), followed by the 22 amino acid sequence of the porcine teschovirus-1 2A (P2A) self-cleaving peptide, and then the first exon of the rat Iba1 gene immediately downstream of the translational start site. Guide RNA with the following sequence: 5'- TACCCTGCAAATCCTTGCTCTGG-3' targeting the Iba1 gene just downstream of the translational start site were used. | 152999023 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 152999023 | RGD | 2026-09-26 02:41:38 | 0 | |||||
|
ZUC-Leprfa Resource Report Resource Website |
RRID:RGD_629464 | Rattus norvegicus | This fatty zucker is derived from Lois and Theodore Zucker colonies from which Research colonies were established at many institutions. | 629464 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 629464 | RGD | 2026-09-26 02:41:38 | 0 | |||||
|
ZUC-Lepr+Ste Resource Report Resource Website |
RRID:RGD_629463 | Rattus norvegicus | This is the littermate of ZUC-LeprfaSte-/-. The fa mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. These rats have lean phenotype. | 629463 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 629463 | RGD | 2026-09-26 02:41:38 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
