Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00050587
Source Database: WormBase (WB)
Affected Genes: WBGene00003377(mls-2)
Genomic Alteration: WBGene00003377(mls-2)
Availability: available
Source References: PMID:35224463
Synonyms: mls-2(vy248[mNG::mls-2]) X.
Alternate IDs: CGC_IX4506
Notes: mNG tag inserted into endogenous mls-2 locus after the start codon using CRISPR/Cas9 engineering, producing a translational mNG::MLS-2 reporter protein. Derived by SEC excision of mls-2(vy247[mNG::SEC::mls-2 knock-in]) in parental strain. mNG::MLS-2 is detected in the nucleus of a few cells in embryos, and localizes to the nucleus of a subset of head cells and the M mesoblast in larvae and adults. Reference: Xiong R., et al. (2022). mNG-tagged mls-2 knock-in alleles in C. elegans. microPublication Biology. 10.17912/micropub.biology.000529.|"[2022-02-11T04:54:57.984Z WBPerson12028] New Strain: mls-2(vy248[mNG::mls-2 knock-in]) X; WBPaper00062471"
Proper citation: RRID:WB-STRAIN:WBStrain00050587 Copy
http://www.wormbase.org/db/get?name=WBStrain00000897
Source Database: WormBase (WB)
Affected Genes: WBGene00001076(dpy-17)|WBGene00002943(let-837)|WBGene00003559(ncl-1)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001076(dpy-17), WBGene00002943(let-837), WBGene00003559(ncl-1), WBGene00006768(unc-32)
Availability: available
Source References: PMID:9862482
Synonyms: dpy-17(e164) let-837(s2834) ncl-1(e1865) unc-32(e189) III; sDp3 (III;f).
Alternate IDs: WB-STRAIN:BC4864, CGC_BC4864
Notes: Maintain by picking Uncs.
Proper citation: RRID:WB-STRAIN:WBStrain00000897 Copy
http://www.wormbase.org/db/get?name=WBStrain00047890
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:31242447
Synonyms: unc-119(ed4) III; syIs360.
Alternate IDs: CGC_PS7127
Notes: Batch Strain object requested via get_NS_ids.pl|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain."|"syIs360 [ets-10p::GFP + unc-119(+)]. Dauer decision marker that indicates commitment to dauer formation in neurons and intestine. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7."
Proper citation: RRID:WB-STRAIN:WBStrain00047890 Copy
http://www.wormbase.org/db/get?name=WBStrain00047942
Source Database: WormBase (WB)
Affected Genes: WBGene00007505(pezo-1)
Genomic Alteration: WBGene00007505(pezo-1)
Availability: available
Source References: PMID:32490809
Synonyms: pezo-1(av144) IV.
Alternate IDs: CGC_AG406
Notes: av144 is a CRISPR/Cas9 engineered deletion in the N-terminal region of pezo-1 removing exons 113. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809.|"Batch Strain object requested via get_NS_ids.pl"|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain."
Proper citation: RRID:WB-STRAIN:WBStrain00047942 Copy
http://www.wormbase.org/db/get?name=WBStrain00047943
Source Database: WormBase (WB)
Affected Genes: WBGene00007505(pezo-1)
Genomic Alteration: WBGene00007505(pezo-1)
Availability: available
Source References: PMID:32490809
Synonyms: pezo-1(av149) IV.
Alternate IDs: CGC_AG416
Notes: av149 is a CRISPR/Cas9 engineered deletion in the C-terminal region of pezo-1 removing the last seven exons (2733) and introns. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809.|"Batch Strain object requested via get_NS_ids.pl"|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain."
Proper citation: RRID:WB-STRAIN:WBStrain00047943 Copy
http://www.wormbase.org/db/get?name=WBStrain00048564
Source Database: WormBase (WB)
Affected Genes: WBGene00003161(mdf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00003161(mdf-2), WBGene00006843(unc-119)
Availability: available
Source References: PMID:31588029
Synonyms: unc-119(ed3) III; mdf-2(lt4::loxP::Cbr-unc-119(+)::loxP) IV/nT1 [qIs51] (IV;V).
Alternate IDs: CGC_OD2174
Notes: CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain."
Proper citation: RRID:WB-STRAIN:WBStrain00048564 Copy
http://www.wormbase.org/db/get?name=WBStrain00048566
Source Database: WormBase (WB)
Affected Genes: WBGene00000868(cyb-3)
Genomic Alteration: WBGene00000868(cyb-3)
Availability: available
Source References: PMID:31588029
Synonyms: cyb-3(lt110) V/nT1 [qIs51] (IV;V).
Alternate IDs: CGC_OD3737
Notes: CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain."
Proper citation: RRID:WB-STRAIN:WBStrain00048566 Copy
http://www.wormbase.org/db/get?name=WBStrain00048568
Source Database: WormBase (WB)
Affected Genes: WBGene00000488(che-7)
Genomic Alteration: WBGene00000488(che-7)
Availability: available
Source References: PMID:32356725
Synonyms: che-7(ot866[che-7::TagRFP]) V.
Alternate IDs: CGC_OH16372
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"tagRFP inserted into endogenous che-7 locus."
Proper citation: RRID:WB-STRAIN:WBStrain00048568 Copy
http://www.wormbase.org/db/get?name=WBStrain00052191
Source Database: WormBase (WB)
Availability: available
Source References: PMID:34824371, PMID:38664429
Synonyms: gtf-2H1(emcSi202[AID::GFP::gtf-2H1]) IV.
Alternate IDs: CGC_HAL504
Notes: CRISPR/Cas9-engineered insertion of AID::GFP tags into N-terminus of endogenous gtf-2H1 locus allowing auxin-induced degradation.|"[2022-05-12T17:36:12.638Z WBPerson12028] New Strain: gtf-2H1(emc202[AID::GFP::gtf-2H1]) IV; WBPaper00062203"
Proper citation: RRID:WB-STRAIN:WBStrain00052191 Copy
http://www.wormbase.org/db/get?name=WBStrain00052378
Source Database: WormBase (WB)
Availability: available
Synonyms: risls32.
Alternate IDs: CGC_MIR262
Notes: Made_by: Fabian Fischer|"risls32 [grh-1p::grh-1b::GFP + unc-119(+)]. Over-expression of grh-1 from its endogenous promoter. Short lived, no GFP signal visible. Reference: Grigolon G, et al. Nat Commun. 2022 Jan 10;13(1):107. doi: 10.1038/s41467-021-27732-4. PMID: 35013237."|"[2022-06-09T04:28:08.261Z WBPerson324] New Strain: wBPaper00062344; Genotype: risIs32[grh-1p::grh-1::gfp]"
Proper citation: RRID:WB-STRAIN:WBStrain00052378 Copy
http://www.wormbase.org/db/get?name=WBStrain00052747
Source Database: WormBase (WB)
Affected Genes: WBGene00002177(jkk-1)
Genomic Alteration: WBGene00002177(jkk-1)
Availability: available
Source References: PMID:37038480
Synonyms: jkk-1(syb3225) X.
Alternate IDs: CGC_PHX3225
Notes: Made_by: Bringmann lab|"Putative jkk-1 gain-of-function allele. Reference: Busack I & Bringmann H. (2023). JKK-1(3E), a JKK-1 mutant with predicted phosphomimetic amino acid substitutions. microPublication Biology. 10.17912/micropub.biology.000785."|"[2023-03-20T22:37:06.807Z WBPerson712] New Strain: WBPaper00065130. PHX3225: jkk-1(syb3225) the phosphomimetic kinase mutant JKK-1(3E), we edited jkk-1 to introduce three amino acid substitutions, S274E, S278E and S280E."
Proper citation: RRID:WB-STRAIN:WBStrain00052747 Copy
http://www.wormbase.org/db/get?name=WBStrain00052743
Source Database: WormBase (WB)
Availability: available
Source References: PMID:35636511
Synonyms: risIs33; gpIs1.
Alternate IDs: CGC_MIR276
Notes: Made_by: Anita Goyala|"risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and TJ375."|"[2023-02-01T19:52:34.889Z WBPerson712] New Strain: MIR276, risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]; gpIs1 [hsp-16.2p::GFP] WBPaper00064116 identifier : pmid35636511"
Proper citation: RRID:WB-STRAIN:WBStrain00052743 Copy
http://www.wormbase.org/db/get?name=WBStrain00052850
Source Database: WormBase (WB)
Affected Genes: WBGene00001187(egl-19)
Genomic Alteration: WBGene00001187(egl-19)
Availability: available
Source References: PMID:37746064
Synonyms: egl-19(utx45[egl-19(A&B)::mScarlet-I-C1::3xMyc] IV.
Alternate IDs: CGC_GLW53
Notes: Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3 (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.|"Made_by: Kara McDonald (Glow Worms '21)"|"[2023-06-29T19:05:01.936Z WBPerson712] New Strain: WBPaper00065588 GLW53 egl-19(utx45[egl-19(ab1-33)::mScarlet::3xMyc::egl-19(ab34-)] IV Referred to herein as mScarlet::EGL-19(ab). Internal mScarlet tag at the 5 end of exon 3 that tags isoforms a and b. The insertion was verified by PCR and fluorescence. Left flank: 5 ttatttgaatgagcaaaaaataaatttcag 3; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3 (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60. Strain available from the CGC."
Proper citation: RRID:WB-STRAIN:WBStrain00052850 Copy
http://www.wormbase.org/db/get?name=WBStrain00048836
Source Database: WormBase (WB)
Availability: available
Synonyms: EMPTY
Alternate IDs: CGC_RW12085
Notes: Modern strain accessioned as a batch with get_NS_ids.pl
Proper citation: RRID:WB-STRAIN:WBStrain00048836 Copy
http://www.wormbase.org/db/get?name=WBStrain00050274
Source Database: WormBase (WB)
Affected Genes: WBGene00011032(ddx-52)
Genomic Alteration: WBGene00011032(ddx-52)
Availability: available
Source References: PMID:32293562, PMID:32652074, PMID:32847964, PMID:33006972, PMID:32958476, PMID:32997655, PMID:33027250, PMID:33034119, PMID:33033228, PMID:33033182, PMID:33065011, PMID:33060131, PMID:33157031, PMID:33096249, PMID:33264285, PMID:33234550, PMID:33239401, PMID:33319748, PMID:33349622, PMID:33361147, PMID:33397797, PMID:33493646, PMID:33516872, PMID:33547005, PMID:33638604, PMID:33677541, PMID:33627403, PMID:33793670, PMID:33820857, PMID:33827942, PMID:33871019, PMID:33963848, PMID:34032213, PMID:34059684, PMID:34114562, PMID:34166401, PMID:34197450, PMID:34195824, PMID:34003969, PMID:34232959, PMID:34244496, PMID:34260587, PMID:34288362, PMID:34312566, PMID:34323218, PMID:34321666, PMID:34397094, PMID:34429473, PMID:34429379, PMID:34469721, PMID:34467850, PMID:34465863, PMID:34373460, PMID:34496246, PMID:34499028, PMID:37039075
Synonyms: ddx-52(gc51) I.
Alternate IDs: CGC_MC817
Notes: ddx-52 mutant|"New Strain - Generated from papers flagged positive during the last month for data type afp_strain/other_strain."|"Temperature-sensitive: can be maintained at 20C, larval arrest (L3) at 25C. gc51 mutants are hypoxia-resistant. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031."|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00050274 Copy
http://www.wormbase.org/db/get?name=WBStrain00050292
Source Database: WormBase (WB)
Affected Genes: WBGene00017989(nol-10)
Genomic Alteration: WBGene00017989(nol-10)
Availability: available
Source References: PMID:32293562, PMID:32652074, PMID:32847964, PMID:33006972, PMID:32958476, PMID:32997655, PMID:33027250, PMID:33034119, PMID:33033228, PMID:33033182, PMID:33065011, PMID:33060131, PMID:33157031, PMID:33096249, PMID:33264285, PMID:33234550, PMID:33239401, PMID:33319748, PMID:33349622, PMID:33361147, PMID:33397797, PMID:33493646, PMID:33516872, PMID:33547005, PMID:33638604, PMID:33677541, PMID:33627403, PMID:33793670, PMID:33820857, PMID:33827942, PMID:33871019, PMID:33963848, PMID:34032213, PMID:34059684, PMID:34114562, PMID:34166401, PMID:34197450, PMID:34195824, PMID:34003969, PMID:34232959, PMID:34244496, PMID:34260587, PMID:34288362, PMID:34312566, PMID:34323218, PMID:34321666, PMID:34397094, PMID:34429473, PMID:34429379, PMID:34469721, PMID:34467850, PMID:34465863, PMID:34373460, PMID:34496246, PMID:34499028
Synonyms: nol-10(gc58) IV.
Alternate IDs: CGC_MC896
Notes: Gain-of-function mutation. Suppresses hypoxia resistance of ddx-52(gc51). Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.|"New Strain - Generated from papers flagged positive during the last month for data type afp_strain/other_strain."|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00050292 Copy
http://www.wormbase.org/db/get?name=WBStrain00050290
Source Database: WormBase (WB)
Affected Genes: WBGene00006739(ulp-4)
Genomic Alteration: WBGene00006739(ulp-4)
Availability: available
Source References: PMID:32293562, PMID:32652074, PMID:32847964, PMID:33006972, PMID:32958476, PMID:32997655, PMID:33027250, PMID:33034119, PMID:33033228, PMID:33033182, PMID:33065011, PMID:33060131, PMID:33157031, PMID:33096249, PMID:33264285, PMID:33234550, PMID:33239401, PMID:33319748, PMID:33349622, PMID:33361147, PMID:33397797, PMID:33493646, PMID:33516872, PMID:33547005, PMID:33638604, PMID:33677541, PMID:33627403, PMID:33793670, PMID:33820857, PMID:33827942, PMID:33871019, PMID:33963848, PMID:34032213, PMID:34059684, PMID:34114562, PMID:34166401, PMID:34197450, PMID:34195824, PMID:34003969, PMID:34232959, PMID:34244496, PMID:34260587, PMID:34288362, PMID:34312566, PMID:34323218, PMID:34321666, PMID:34397094, PMID:34429473, PMID:34429379, PMID:34469721, PMID:34467850, PMID:34465863, PMID:34373460, PMID:34496246, PMID:34499028
Synonyms: ulp-4(gc54) II.
Alternate IDs: CGC_MC894
Notes: New Strain - Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"Suppresses hypoxia resistance of ddx-52(gc51). gc54 and gc55 are both missense alleles of ulp-4, but may behave somewhat differently. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031."|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00050290 Copy
http://www.wormbase.org/db/get?name=WBStrain00050297
Source Database: WormBase (WB)
Affected Genes: WBGene00022269(aatf-1)
Genomic Alteration: WBGene00022269(aatf-1)
Availability: available
Source References: PMID:32293562, PMID:32652074, PMID:32847964, PMID:33006972, PMID:32958476, PMID:32997655, PMID:33027250, PMID:33034119, PMID:33033228, PMID:33033182, PMID:33065011, PMID:33060131, PMID:33157031, PMID:33096249, PMID:33264285, PMID:33234550, PMID:33239401, PMID:33319748, PMID:33349622, PMID:33361147, PMID:33397797, PMID:33493646, PMID:33516872, PMID:33547005, PMID:33638604, PMID:33677541, PMID:33627403, PMID:33793670, PMID:33820857, PMID:33827942, PMID:33871019, PMID:33963848, PMID:34032213, PMID:34059684, PMID:34114562, PMID:34166401, PMID:34197450, PMID:34195824, PMID:34003969, PMID:34232959, PMID:34244496, PMID:34260587, PMID:34288362, PMID:34312566, PMID:34323218, PMID:34321666, PMID:34397094, PMID:34429473, PMID:34429379, PMID:34469721, PMID:34467850, PMID:34465863, PMID:34373460, PMID:34496246, PMID:34499028
Synonyms: aatf-1(gc63 gc64) I.
Alternate IDs: CGC_MC907
Notes: Gain-of-function mutation. Suppresses hypoxia resistance of ddx-52(gc51). gc63 gc64 occurred in the same mutagenesis; unclear which allele (or if both) is causing the gain of function. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.|"New Strain - Generated from papers flagged positive during the last month for data type afp_strain/other_strain."|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00050297 Copy
http://www.wormbase.org/db/get?name=WBStrain00045475
Source Database: WormBase (WB)
Availability: available
Synonyms: ustSi25 II.
Alternate IDs: CGC_SHG487
Notes: Generated based on CalTech XREF data|"ustSi25 [wago-4p::3xFlag::GFP::wago-4::wago-4 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Xu F, et al. Cell rep. 2018 May 22;23(8):2482-2494. doi: 10.1016/j.celrep.2018.04.072. PMID: 29791857."
Proper citation: RRID:WB-STRAIN:WBStrain00045475 Copy
http://www.wormbase.org/db/get?name=WBStrain00046991
Source Database: WormBase (WB)
Availability: available
Synonyms: Serratia marcescens
Alternate IDs: WB-STRAIN:IGX2, CGC_IGX2
Notes: Db11. Tetracyclin, streptomycin and kanamycin resistant. A spontaneous mutant resistant to streptomycin isolated from Db10. See Flyg, Kenne K, Boman HG: Insect pathogenic properties of Serratia marcescens: phage-resistant mutants with a decreased resistance to Cecropia immunity and a decreased virulence to Drosophila. J. Gen. Microbiol. 1980; 120: 173-181.|"No longer available from the CGC catalogue 24/04/2020"|"Non-elegans Strain"
Proper citation: RRID:WB-STRAIN:WBStrain00046991 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
