Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00003813

Source Database: WormBase (WB)
Affected Genes: WBGene00004743(scm-1)|WBGene00004912(sng-1)|WBGene00004979(sph-1)
Genomic Alteration: WBGene00004743(scm-1), WBGene00004912(sng-1), WBGene00004979(sph-1)
Availability: available
Source References: EMPTY
Synonyms: scm-1(hd30) I; sph-1(ox278) IV; sng-1(ok234) X.
Alternate IDs: WB-STRAIN:BJ21, CGC_BJ21
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00003813 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003810

Source Database: WormBase (WB)
Affected Genes: WBGene00004399(rol-9)
Genomic Alteration: WBGene00004399(rol-9)
Availability: available
Source References: EMPTY
Synonyms: rol-9(sc149) V.
Alternate IDs: WB-STRAIN:BE149, CGC_BE149
Notes: Strong right roller.

Proper citation: RRID:WB-STRAIN:WBStrain00003810 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003898

Source Database: WormBase (WB)
Affected Genes: WBGene00000100(ajm-1)|WBGene00000439(ceh-16)|WBGene00002980(lgg-1)
Genomic Alteration: WBGene00000100(ajm-1), WBGene00000439(ceh-16), WBGene00002980(lgg-1)
Availability: available
Source References: EMPTY
Synonyms: ceh-16(lg16) III; jcIs1 IV; ngEx1.
Alternate IDs: WB-STRAIN:BR2958, CGC_BR2958
Notes: jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ngEx1[ceh-16::GFP]. ngEx1 rescues ceh-16(lg16) lethality. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and the gene encoding the antigen recognized by the monoclonal antibody MH27. jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Cassata et al. Development. 2005 Feb;132(4):739-49.|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00061621 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00003898 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003897

Source Database: WormBase (WB)
Affected Genes: WBGene00000500(chn-1)
Genomic Alteration: WBGene00000500(chn-1)
Availability: available
Source References: PMID:39384041
Synonyms: chn-1(by155) I.
Alternate IDs: WB-STRAIN:BR2823, CGC_BR2823
Notes: 989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747.|"Made_by: Hoppe/Sperl"

Proper citation: RRID:WB-STRAIN:WBStrain00003897 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003894

Source Database: WormBase (WB)
Affected Genes: WBGene00003877(pept-1)
Genomic Alteration: WBGene00003877(pept-1)
Availability: available
Source References: PMID:33157031, PMID:38991033, PMID:39284915
Synonyms: pept-1(lg601) X.
Alternate IDs: WB-STRAIN:BR2742, CGC_BR2742
Notes: Made_by: Elegene|"Mutagen:UV/TMP"|"Slow postembryonic development. Reduced brood size. Previously known as pep-2. [NOTE: the genotype of this strain was previously incorrectly annotated as lg1601. The correct allele name is lg601.] Reference: Meissner B, et al. J Biol Chem. 2004 Aug 27;279(35):36739-45."|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00003894 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003829

Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)
Genomic Alteration: WBGene00001867(him-8)
Availability: available
Source References: PMID:34534446
Synonyms: inIs179 [ida-1p::GFP] II; him-8(e1489) IV
Alternate IDs: WB-STRAIN:BL5717, CGC_BL5717
Notes: inIs179 [ida-1p::GFP]. GFP is expressed in a subset of neurons and the neuroendocrine uv1 cells of the vulva. Identified neurons include ADE, ALA, ASI, ASK, AUA, ASG, AVH, AVJ, AVK, VC, HSN, PDE, PVP, PHA, PHB, PHC. Male sex-specific neurons include CA and some ray neurons. Plasmid pida-1::GFP 7.6 was injected into N2 and integrated to generate BL5715, then crossed into him-8(e1489) background.|"Made_by: T Zahn/P MacMorris"|"Mutagen:Gamma rays"

Proper citation: RRID:WB-STRAIN:WBStrain00003829 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003838

Source Database: WormBase (WB)
Affected Genes: WBGene00003805(npp-19)
Genomic Alteration: WBGene00003805(npp-19)
Availability: available
Source References: PMID:37995185
Synonyms: npp-19(tm2886) II; bqIs7.
Alternate IDs: WB-STRAIN:BN46, CGC_BN46
Notes: bqIs7 [pie-1p::LAP::npp-19 + unc-119(+)]; rescues Emb defects. Rodenas et al, Dev Biol. 2009 327:399-409.|"Supplementary_genotype GFP-NPP-19; bqIs7 [pie-1p:LAP:npp-19 + unc-119(+)]"

Proper citation: RRID:WB-STRAIN:WBStrain00003838 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003837

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003791(npp-5)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003791(npp-5)
Availability: available
Source References: EMPTY
Synonyms: npp-5(tm3039)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:BN40, CGC_BN40
Notes: Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. tm3039 homozygotes are viable but produce progengy that are primarily Lva or Lvl. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.

Proper citation: RRID:WB-STRAIN:WBStrain00003837 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003833

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00017895(vrk-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00017895(vrk-1)
Availability: available
Source References: EMPTY
Synonyms: vrk-1(ok1181)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:BN3, CGC_BN3
Notes: F28B12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1181 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Klerkx et al, Dev Biol. 2009 335:12-21.

Proper citation: RRID:WB-STRAIN:WBStrain00003833 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003968

Source Database: WormBase (WB)
Affected Genes: WBGene00006331(sup-26)
Genomic Alteration: WBGene00006331(sup-26)
Availability: available
Source References: EMPTY
Synonyms: sup-26(n1091) III.
Alternate IDs: WB-STRAIN:BW916, CGC_BW916
Notes: Superficially wild-type. Maintain under normal conditions. Reference: Manser J, et al. (2002) Genesis 34(3):184-95.

Proper citation: RRID:WB-STRAIN:WBStrain00003968 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003962

Source Database: WormBase (WB)
Affected Genes: WBGene00002999(lin-10)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00002999(lin-10), WBGene00006752(unc-13)
Availability: available
Source References: EMPTY
Synonyms: unc-13(e1091) lin-10(e1438) I.
Alternate IDs: WB-STRAIN:BW538, CGC_BW538
Notes: Unc and Vul.

Proper citation: RRID:WB-STRAIN:WBStrain00003962 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003961

Source Database: WormBase (WB)
Affected Genes: WBGene00000435(ceh-10)
Genomic Alteration: WBGene00000435(ceh-10)
Availability: available
Source References: PMID:2361334
Synonyms: ceh-10(ct78) III.
Alternate IDs: WB-STRAIN:BW506, CGC_BW506
Notes: Withered tail. Adults shorter than WT. Embryonic cell migrations affected: CAN migration with high penetrance. Previously called mig-11.

Proper citation: RRID:WB-STRAIN:WBStrain00003961 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003979

Source Database: WormBase (WB)
Affected Genes: WBGene00006759(unc-22)
Genomic Alteration: WBGene00006759(unc-22)
Availability: available
Source References: PMID:7906415
Synonyms: unc-22(ct171) IV.
Alternate IDs: WB-STRAIN:BW1163, CGC_BW1163
Notes: Mutagen: Trimethylpsoalen|"Twitcher."

Proper citation: RRID:WB-STRAIN:WBStrain00003979 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003978

Source Database: WormBase (WB)
Affected Genes: WBGene00006759(unc-22)
Genomic Alteration: WBGene00006759(unc-22)
Availability: available
Source References: PMID:7906415
Synonyms: unc-22(ct169) IV.
Alternate IDs: WB-STRAIN:BW1161, CGC_BW1161
Notes: Mutagen: Trimethylpsoalen|"Twitcher."

Proper citation: RRID:WB-STRAIN:WBStrain00003978 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003975

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003184(mei-2)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003184(mei-2), WBGene00006765(unc-29)
Availability: available
Source References: PMID:2249759
Synonyms: dpy-5(e61) mei-2(ct102) unc-29(e1072) I; sDp2 (I;f).
Alternate IDs: WB-STRAIN:BW1102, CGC_BW1102
Notes: Animals with the duplication are Unc. Animals that have lost the duplication are DpyUncMel. mei-2 is non-conditional recessive maternal effect lethal.|"Made_by: Mains & Sulston"

Proper citation: RRID:WB-STRAIN:WBStrain00003975 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003971

Source Database: WormBase (WB)
Affected Genes: WBGene00000904(daf-8)|WBGene00006773(unc-37)
Genomic Alteration: WBGene00000904(daf-8), WBGene00006773(unc-37)
Availability: available
Source References: EMPTY
Synonyms: unc-37(e262) daf-8(e1393) I.
Alternate IDs: WB-STRAIN:BW1046, CGC_BW1046
Notes: Unc. Constitutive dauer formation (Daf-c) at 25C.

Proper citation: RRID:WB-STRAIN:WBStrain00003971 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003972

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00006776(unc-40)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006776(unc-40)
Availability: available
Source References: EMPTY
Synonyms: unc-40(e271) bli-4(e937) I.
Alternate IDs: WB-STRAIN:BW1049, CGC_BW1049
Notes: UncBli Strain. Blisters late.

Proper citation: RRID:WB-STRAIN:WBStrain00003972 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003990

Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00003912(pal-1)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00003912(pal-1)
Availability: available
Source References: EMPTY
Synonyms: pal-1(ct281)/qC1 [dpy-19(e1259) glp-1(q339)] III.
Alternate IDs: WB-STRAIN:BW1563, CGC_BW1563
Notes: Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct281 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct281 is a 4.7kb deletion removing intron 5, exon 6, and the 3'UTR of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.

Proper citation: RRID:WB-STRAIN:WBStrain00003990 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003907

Source Database: WormBase (WB)
Affected Genes: WBGene00006526(tax-4)
Genomic Alteration: WBGene00006526(tax-4)
Availability: available
Source References: EMPTY
Synonyms: tax-4(p678) III; byEx836.
Alternate IDs: WB-STRAIN:BR5602, CGC_BR5602
Notes: byEx836 [odr-4p::tax-4::GFP + myo-2p::mCherry]. Pick mCherry+ animals to maintain. Rescues tax-4 null mutant. Expresses tax-4(+) in AWA, AWB, AWC, ADF, ASG, ASH, ASI, ASJ, ASK, ADL, PHA, and PHB sensory neurons, but not AFD sensory neurons. Reference: Liu S, Schulze E, Baumeister R. PLoS One. 2012;7(3):e32360.

Proper citation: RRID:WB-STRAIN:WBStrain00003907 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00003904

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: byIs162; bkIs10.
Alternate IDs: WB-STRAIN:BR5486, CGC_BR5486
Notes: byIs162 [rab-3p::F3(delta)K280(I277P)(I308P) + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 anti-aggregation Tau fragment (with two I to P substitutions) and full-length Tau in all neurons. Red and green fluorescence in the pharynx due to the co-injection markers. The F3/2P fragment is not able to nucleate aggregation of full length Tau. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

Proper citation: RRID:WB-STRAIN:WBStrain00003904 Copy   

•   Source: Integrated Animals