Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
BJ21 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003813 | Caenorhabditis elegans | scm-1(hd30) I; sph-1(ox278) IV; sng-1(ok234) X. | EMPTY | WBGene00004743(scm-1)|WBGene00004912(sng-1)|WBGene00004979(sph-1) | WBGene00004743(scm-1), WBGene00004912(sng-1), WBGene00004979(sph-1) | WB-STRAIN:WBStrain00003813 | WormBase (WB) | WB | available | WB-STRAIN:BJ21, CGC_BJ21 | 2026-08-01 10:11:16 | 0 | |||
|
BE149 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003810 | Caenorhabditis elegans | rol-9(sc149) V. | Strong right roller. | WBGene00004399(rol-9) | WBGene00004399(rol-9) | WB-STRAIN:WBStrain00003810 | WormBase (WB) | WB | available | WB-STRAIN:BE149, CGC_BE149 | 2026-08-01 10:11:16 | 0 | |||
|
BR2958 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003898 | Caenorhabditis elegans | ceh-16(lg16) III; jcIs1 IV; ngEx1. | jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ngEx1[ceh-16::GFP]. ngEx1 rescues ceh-16(lg16) lethality. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and the gene encoding the antigen recognized by the monoclonal antibody MH27. jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Cassata et al. Development. 2005 Feb;132(4):739-49.|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00061621 added based on AFP_Strain data." | WBGene00000100(ajm-1)|WBGene00000439(ceh-16)|WBGene00002980(lgg-1) | WBGene00000100(ajm-1), WBGene00000439(ceh-16), WBGene00002980(lgg-1) | WB-STRAIN:WBStrain00003898 | WormBase (WB) | WB | available | WB-STRAIN:BR2958, CGC_BR2958 | 2026-08-01 10:11:18 | 0 | |||
|
BR2823 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00003897 | Caenorhabditis elegans | chn-1(by155) I. | 989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747.|"Made_by: Hoppe/Sperl" | WBGene00000500(chn-1) | WBGene00000500(chn-1) | WB-STRAIN:WBStrain00003897 | WormBase (WB) | WB | available | PMID:39384041 | WB-STRAIN:BR2823, CGC_BR2823 | 2026-08-01 10:11:18 | 2 | ||
|
BR2742 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00003894 | Caenorhabditis elegans | pept-1(lg601) X. | Made_by: Elegene|"Mutagen:UV/TMP"|"Slow postembryonic development. Reduced brood size. Previously known as pep-2. [NOTE: the genotype of this strain was previously incorrectly annotated as lg1601. The correct allele name is lg601.] Reference: Meissner B, et al. J Biol Chem. 2004 Aug 27;279(35):36739-45."|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data." | WBGene00003877(pept-1) | WBGene00003877(pept-1) | WB-STRAIN:WBStrain00003894 | WormBase (WB) | WB | available | PMID:33157031 PMID:38991033 PMID:39284915 |
WB-STRAIN:BR2742, CGC_BR2742 | 2026-08-01 10:11:18 | 3 | ||
|
BL5717 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00003829 | Caenorhabditis elegans | inIs179 [ida-1p::GFP] II; him-8(e1489) IV | inIs179 [ida-1p::GFP]. GFP is expressed in a subset of neurons and the neuroendocrine uv1 cells of the vulva. Identified neurons include ADE, ALA, ASI, ASK, AUA, ASG, AVH, AVJ, AVK, VC, HSN, PDE, PVP, PHA, PHB, PHC. Male sex-specific neurons include CA and some ray neurons. Plasmid pida-1::GFP 7.6 was injected into N2 and integrated to generate BL5715, then crossed into him-8(e1489) background.|"Made_by: T Zahn/P MacMorris"|"Mutagen:Gamma rays" | WBGene00001867(him-8) | WBGene00001867(him-8) | WB-STRAIN:WBStrain00003829 | WormBase (WB) | WB | available | PMID:34534446 | WB-STRAIN:BL5717, CGC_BL5717 | 2026-08-01 10:11:17 | 2 | ||
|
BN46 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003838 | Caenorhabditis elegans | npp-19(tm2886) II; bqIs7. | bqIs7 [pie-1p::LAP::npp-19 + unc-119(+)]; rescues Emb defects. Rodenas et al, Dev Biol. 2009 327:399-409.|"Supplementary_genotype GFP-NPP-19; bqIs7 [pie-1p:LAP:npp-19 + unc-119(+)]" | WBGene00003805(npp-19) | WBGene00003805(npp-19) | WB-STRAIN:WBStrain00003838 | WormBase (WB) | WB | available | PMID:37995185 | WB-STRAIN:BN46, CGC_BN46 | 2026-08-01 10:11:17 | 0 | ||
|
BN40 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003837 | Caenorhabditis elegans | npp-5(tm3039)/mIn1 [mIs14 dpy-10(e128)] II. | Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. tm3039 homozygotes are viable but produce progengy that are primarily Lva or Lvl. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44. | WBGene00001072(dpy-10)|WBGene00003791(npp-5) | WBGene00001072(dpy-10), WBGene00003791(npp-5) | WB-STRAIN:WBStrain00003837 | WormBase (WB) | WB | available | WB-STRAIN:BN40, CGC_BN40 | 2026-08-01 10:11:17 | 0 | |||
|
BN3 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003833 | Caenorhabditis elegans | vrk-1(ok1181)/mIn1 [mIs14 dpy-10(e128)] II. | F28B12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1181 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Klerkx et al, Dev Biol. 2009 335:12-21. | WBGene00001072(dpy-10)|WBGene00017895(vrk-1) | WBGene00001072(dpy-10), WBGene00017895(vrk-1) | WB-STRAIN:WBStrain00003833 | WormBase (WB) | WB | available | WB-STRAIN:BN3, CGC_BN3 | 2026-08-01 10:11:17 | 0 | |||
|
BW916 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003968 | Caenorhabditis elegans | sup-26(n1091) III. | Superficially wild-type. Maintain under normal conditions. Reference: Manser J, et al. (2002) Genesis 34(3):184-95. | WBGene00006331(sup-26) | WBGene00006331(sup-26) | WB-STRAIN:WBStrain00003968 | WormBase (WB) | WB | available | WB-STRAIN:BW916, CGC_BW916 | 2026-08-01 10:11:19 | 0 | |||
|
BW538 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003962 | Caenorhabditis elegans | unc-13(e1091) lin-10(e1438) I. | Unc and Vul. | WBGene00002999(lin-10)|WBGene00006752(unc-13) | WBGene00002999(lin-10), WBGene00006752(unc-13) | WB-STRAIN:WBStrain00003962 | WormBase (WB) | WB | available | WB-STRAIN:BW538, CGC_BW538 | 2026-08-01 10:11:19 | 0 | |||
|
BW506 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003961 | Caenorhabditis elegans | ceh-10(ct78) III. | Withered tail. Adults shorter than WT. Embryonic cell migrations affected: CAN migration with high penetrance. Previously called mig-11. | WBGene00000435(ceh-10) | WBGene00000435(ceh-10) | WB-STRAIN:WBStrain00003961 | WormBase (WB) | WB | available | PMID:2361334 | WB-STRAIN:BW506, CGC_BW506 | 2026-08-01 10:11:19 | 0 | ||
|
BW1163 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003979 | Caenorhabditis elegans | unc-22(ct171) IV. | Mutagen: Trimethylpsoalen|"Twitcher." | WBGene00006759(unc-22) | WBGene00006759(unc-22) | WB-STRAIN:WBStrain00003979 | WormBase (WB) | WB | available | PMID:7906415 | WB-STRAIN:BW1163, CGC_BW1163 | 2026-08-01 10:11:19 | 0 | ||
|
BW1161 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003978 | Caenorhabditis elegans | unc-22(ct169) IV. | Mutagen: Trimethylpsoalen|"Twitcher." | WBGene00006759(unc-22) | WBGene00006759(unc-22) | WB-STRAIN:WBStrain00003978 | WormBase (WB) | WB | available | PMID:7906415 | WB-STRAIN:BW1161, CGC_BW1161 | 2026-08-01 10:11:19 | 0 | ||
|
BW1102 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003975 | Caenorhabditis elegans | dpy-5(e61) mei-2(ct102) unc-29(e1072) I; sDp2 (I;f). | Animals with the duplication are Unc. Animals that have lost the duplication are DpyUncMel. mei-2 is non-conditional recessive maternal effect lethal.|"Made_by: Mains & Sulston" | WBGene00001067(dpy-5)|WBGene00003184(mei-2)|WBGene00006765(unc-29) | WBGene00001067(dpy-5), WBGene00003184(mei-2), WBGene00006765(unc-29) | WB-STRAIN:WBStrain00003975 | WormBase (WB) | WB | available | PMID:2249759 | WB-STRAIN:BW1102, CGC_BW1102 | 2026-08-01 10:11:19 | 0 | ||
|
BW1046 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003971 | Caenorhabditis elegans | unc-37(e262) daf-8(e1393) I. | Unc. Constitutive dauer formation (Daf-c) at 25C. | WBGene00000904(daf-8)|WBGene00006773(unc-37) | WBGene00000904(daf-8), WBGene00006773(unc-37) | WB-STRAIN:WBStrain00003971 | WormBase (WB) | WB | available | WB-STRAIN:BW1046, CGC_BW1046 | 2026-08-01 10:11:19 | 0 | |||
|
BW1049 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003972 | Caenorhabditis elegans | unc-40(e271) bli-4(e937) I. | UncBli Strain. Blisters late. | WBGene00000254(bli-4)|WBGene00006776(unc-40) | WBGene00000254(bli-4), WBGene00006776(unc-40) | WB-STRAIN:WBStrain00003972 | WormBase (WB) | WB | available | WB-STRAIN:BW1049, CGC_BW1049 | 2026-08-01 10:11:19 | 0 | |||
|
BW1563 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003990 | Caenorhabditis elegans | pal-1(ct281)/qC1 [dpy-19(e1259) glp-1(q339)] III. | Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct281 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct281 is a 4.7kb deletion removing intron 5, exon 6, and the 3'UTR of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88. | WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00003912(pal-1) | WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00003912(pal-1) | WB-STRAIN:WBStrain00003990 | WormBase (WB) | WB | available | WB-STRAIN:BW1563, CGC_BW1563 | 2026-08-01 10:11:19 | 0 | |||
|
BR5602 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003907 | Caenorhabditis elegans | tax-4(p678) III; byEx836. | byEx836 [odr-4p::tax-4::GFP + myo-2p::mCherry]. Pick mCherry+ animals to maintain. Rescues tax-4 null mutant. Expresses tax-4(+) in AWA, AWB, AWC, ADF, ASG, ASH, ASI, ASJ, ASK, ADL, PHA, and PHB sensory neurons, but not AFD sensory neurons. Reference: Liu S, Schulze E, Baumeister R. PLoS One. 2012;7(3):e32360. | WBGene00006526(tax-4) | WBGene00006526(tax-4) | WB-STRAIN:WBStrain00003907 | WormBase (WB) | WB | available | WB-STRAIN:BR5602, CGC_BR5602 | 2026-08-01 10:11:18 | 0 | |||
|
BR5486 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003904 | Caenorhabditis elegans | byIs162; bkIs10. | byIs162 [rab-3p::F3(delta)K280(I277P)(I308P) + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 anti-aggregation Tau fragment (with two I to P substitutions) and full-length Tau in all neurons. Red and green fluorescence in the pharynx due to the co-injection markers. The F3/2P fragment is not able to nucleate aggregation of full length Tau. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603. | WB-STRAIN:WBStrain00003904 | WormBase (WB) | WB | available | WB-STRAIN:BR5486, CGC_BR5486 | 2026-08-01 10:11:18 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
