Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00003947
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003783(nos-1)|WBGene00003784(nos-2)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003783(nos-1), WBGene00003784(nos-2)
Availability: available
Source References: EMPTY
Synonyms: nos-2(ok230) nos-1(gv5)/mIn1 [dpy-10(e128) mIs14] II.
Alternate IDs: WB-STRAIN:BS5351, CGC_BS5351
Notes: Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nos-2 nos-1 homozygotes (segregate many dead embryos). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. Reference: Hansen D, et al. Development. 2004 Jan;131(1):93-104.
Proper citation: RRID:WB-STRAIN:WBStrain00003947 Copy
http://www.wormbase.org/db/get?name=WBStrain00003945
Source Database: WormBase (WB)
Affected Genes: WBGene00001303(sec-61.G)|WBGene00004855(sma-1)
Genomic Alteration: WBGene00001303(sec-61.G), WBGene00004855(sma-1)
Availability: available
Source References: PMID:8707849
Synonyms: sec-61.G(oz1) sma-1(e30) V/nT1 [unc-?(n754) let-?] (IV;V).
Alternate IDs: WB-STRAIN:BS5182, CGC_BS5182
Notes: Heterozygotes are Unc and segregate Unc, dead eggs and Sma. sec-61.G sma-1 homozygotes grow up to be sterile adults, with endomitotic oocytes in the gonad arm. sec-61.G also known as emo-1.
Proper citation: RRID:WB-STRAIN:WBStrain00003945 Copy
http://www.wormbase.org/db/get?name=WBStrain00003942
Source Database: WormBase (WB)
Affected Genes: WBGene00004057(pmk-3)
Genomic Alteration: WBGene00004057(pmk-3)
Availability: available
Source References: PMID:37310929, PMID:39532199
Synonyms: pmk-3(ok169).
Alternate IDs: WB-STRAIN:BS3383, CGC_BS3383
Notes: F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.|"Made_by: Barstead/Moulder"
Proper citation: RRID:WB-STRAIN:WBStrain00003942 Copy
http://www.wormbase.org/db/get?name=WBStrain00003943
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001595(gld-1)|WBGene00001596(gld-2)|WBGene00001609(glp-1)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001595(gld-1), WBGene00001596(gld-2), WBGene00001609(glp-1), WBGene00006768(unc-32)
Availability: available
Source References: EMPTY
Synonyms: gld-2(q497) gld-1(q485)/hT2 [dpy-18(h662)] I; unc-32(e189) glp-1(q175)/hT2 [bli-4(e937)] III.
Alternate IDs: WB-STRAIN:BS3392, CGC_BS3392
Notes: Heterozygotes are wild-type and segregate WT heterozygotes, Unc (gld-2 gld-1; unc-32 glp-1 homozygotes), and Dpy (hT2 homozygotes; the bli-4 mutation is suppressed by dpy-18). Check Unc-32 animals for tumors to confirm presence of glp-1 in the line. glp-1(q175) is nonsense R191 > stop (opal).
Proper citation: RRID:WB-STRAIN:WBStrain00003943 Copy
http://www.wormbase.org/db/get?name=WBStrain00003940
Source Database: WormBase (WB)
Affected Genes: WBGene00003030(lin-45)
Genomic Alteration: WBGene00003030(lin-45)
Availability: available
Source References: EMPTY
Synonyms: lin-45(dx84) IV/nT1 [unc-?(n754) let-?] (IV;V).
Alternate IDs: WB-STRAIN:BS3347, CGC_BS3347
Notes: Heterozygotes are Unc and segregate Unc heterozygotes, non-Unc Steriles (lin-45 homozygotes), larval lethals, and dead eggs. dx84 is a strong lin-45 raf allele: dx84 homozygotes from dx84/+ heterozygotes are 47% larval lethal and among the adults, 100% are Sterile and Vul.
Proper citation: RRID:WB-STRAIN:WBStrain00003940 Copy
http://www.wormbase.org/db/get?name=WBStrain00003941
Source Database: WormBase (WB)
Affected Genes: WBGene00007396(rnp-9)
Genomic Alteration: WBGene00007396(rnp-9)
Availability: available
Source References: EMPTY
Synonyms: C07A4.1(ok144) X.
Alternate IDs: WB-STRAIN:BS3348, CGC_BS3348
Notes: Primers used to detect the deletion: IQ789.E1: CACACATCGGTCTTCCACAC. IQ789.E2: AATGAAACACCGGAAACTCG. IQ789.I1: TGCAATTGTGTTGCAGGAAT. IQ789.I2: AAAAGAGTGGCTGGCTCGTA.
Proper citation: RRID:WB-STRAIN:WBStrain00003941 Copy
http://www.wormbase.org/db/get?name=WBStrain00003953
Source Database: WormBase (WB)
Affected Genes: WBGene00001079(dpy-20)|WBGene00001403(fbl-1)|WBGene00006761(unc-24)
Genomic Alteration: WBGene00001079(dpy-20), WBGene00001403(fbl-1), WBGene00006761(unc-24)
Availability: available
Source References: EMPTY
Synonyms: fbl-1(hd43)/dpy-20(e1282) unc-24(e138) IV.
Alternate IDs: WB-STRAIN:BT14, CGC_BT14
Notes: Heterozygotes are WT and segregate WT, Steriles (hd43 homozygotes) and Dpy Uncs.|"Made_by: Hutter/Muriel"
Proper citation: RRID:WB-STRAIN:WBStrain00003953 Copy
http://www.wormbase.org/db/get?name=WBStrain00003951
Source Database: WormBase (WB)
Affected Genes: WBGene00001063(dpy-1)|WBGene00017328(nemp-1)
Genomic Alteration: WBGene00001063(dpy-1), WBGene00017328(nemp-1)
Availability: available
Source References: PMID:32923640
Synonyms: nemp-1(oz535)/sC1(s2023) [dpy-1(s2170) umnIs41] III.
Alternate IDs: WB-STRAIN:BS7012, CGC_BS7012
Notes: Made_by: Ariz Mohammad|"Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz535) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz535) homozygotes are sterile."
Proper citation: RRID:WB-STRAIN:WBStrain00003951 Copy
http://www.wormbase.org/db/get?name=WBStrain00003952
Source Database: WormBase (WB)
Affected Genes: WBGene00001863(him-4)
Genomic Alteration: WBGene00001863(him-4)
Availability: available
Source References: PMID:38177158
Synonyms: him-4(rh319) X.
Alternate IDs: WB-STRAIN:BT12, CGC_BT12
Notes: Him. Reference: Vogel BE, Hedgecock EM. (2001) Development. 128:883-94.
Proper citation: RRID:WB-STRAIN:WBStrain00003952 Copy
http://www.wormbase.org/db/get?name=WBStrain00003950
Source Database: WormBase (WB)
Affected Genes: WBGene00001063(dpy-1)|WBGene00017328(nemp-1)
Genomic Alteration: WBGene00001063(dpy-1), WBGene00017328(nemp-1)
Availability: available
Source References: PMID:32923640
Synonyms: nemp-1(oz534)/sC1(s2023) [dpy-1(s2170) umnIs41] III.
Alternate IDs: WB-STRAIN:BS7011, CGC_BS7011
Notes: Made_by: Ariz Mohammad|"Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz534) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz534) homozygotes are sterile."
Proper citation: RRID:WB-STRAIN:WBStrain00003950 Copy
http://www.wormbase.org/db/get?name=WBStrain00004020
Source Database: WormBase (WB)
Affected Genes: WBGene00001399(fat-7)
Genomic Alteration: WBGene00001399(fat-7)
Availability: available
Source References: PMID:33009389, PMID:36653384, PMID:37541249
Synonyms: fat-7(wa36) V.
Alternate IDs: WB-STRAIN:BX153, CGC_BX153
Notes: Made_by:|"Supplementary_genotype fat-7(wa36)"
Proper citation: RRID:WB-STRAIN:WBStrain00004020 Copy
http://www.wormbase.org/db/get?name=WBStrain00004019
Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: PMID:37118502
Synonyms: lin15B, A(n765) X; waEx18 [fat-5::GFP +lin15(+)]
Alternate IDs: WB-STRAIN:BX150, CGC_BX150
Notes: waEx18 [fat-5::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.
Proper citation: RRID:WB-STRAIN:WBStrain00004019 Copy
http://www.wormbase.org/db/get?name=WBStrain00004018
Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: PMID:38374083
Synonyms: lin-15B&lin-15A(n765) X; waEx16.
Alternate IDs: WB-STRAIN:BX115, CGC_BX115
Notes: waEx16 [fat-6::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.
Proper citation: RRID:WB-STRAIN:WBStrain00004018 Copy
http://www.wormbase.org/db/get?name=WBStrain00004015
Source Database: WormBase (WB)
Affected Genes: WBGene00001397(fat-5)
Genomic Alteration: WBGene00001397(fat-5)
Availability: available
Source References: PMID:32302543, PMID:36653384, PMID:37541249
Synonyms: fat-5(tm420) V.
Alternate IDs: WB-STRAIN:BX107, CGC_BX107
Notes: Mutagen:UV/TMP|"Received new stock with confirmed deletion from Jennifer Watts 07/16/2009."|"Supplementary_genotype fat-5(tm420)"|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00004015 Copy
http://www.wormbase.org/db/get?name=WBStrain00004013
Source Database: WormBase (WB)
Affected Genes: WBGene00001393(fat-1)|WBGene00001396(fat-4)
Genomic Alteration: WBGene00001393(fat-1), WBGene00001396(fat-4)
Availability: available
Source References: PMID:37541249
Synonyms: fat-4(wa14) fat-1(wa9) IV.
Alternate IDs: WB-STRAIN:BX52, CGC_BX52
Notes: Made_by:|"Supplementary_genotype fat-4(wa14) fat-1(wa9)"
Proper citation: RRID:WB-STRAIN:WBStrain00004013 Copy
http://www.wormbase.org/db/get?name=WBStrain00004014
Source Database: WormBase (WB)
Affected Genes: WBGene00001398(fat-6)
Genomic Alteration: WBGene00001398(fat-6)
Availability: available
Source References: PMID:36653384
Synonyms: fat-6(tm331) IV.
Alternate IDs: WB-STRAIN:BX106, CGC_BX106
Notes: Mutagen:UV/TP|"Received new stock with confirmed deletion from Jennifer Watts 07/16/2009."
Proper citation: RRID:WB-STRAIN:WBStrain00004014 Copy
http://www.wormbase.org/db/get?name=WBStrain00004025
Source Database: WormBase (WB)
Affected Genes: WBGene00022200(fard-1)
Genomic Alteration: WBGene00022200(fard-1)
Availability: available
Source References: PMID:37606250
Synonyms: fard-1(wa28) X.
Alternate IDs: WB-STRAIN:BX275, CGC_BX275
Notes: Deficient in synthesis of ether-linked lipids. Contains high content of saturated fatty acids. Reference: Shi X, et al. J Lipid Res. 2016 Feb;57(2):265-75.
Proper citation: RRID:WB-STRAIN:WBStrain00004025 Copy
http://www.wormbase.org/db/get?name=WBStrain00004044
Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)
Genomic Alteration: WBGene00001867(him-8)
Availability: available
Source References: PMID:33575816, PMID:33740426, PMID:37078421
Synonyms: him-8(tm611) IV.
Alternate IDs: WB-STRAIN:CA257, CGC_CA257
Notes: 37% XO self progeny. Recessive.|"WBStrain mapped, WBPaper00061039 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061201 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00004044 Copy
http://www.wormbase.org/db/get?name=WBStrain00004045
Source Database: WormBase (WB)
Affected Genes: WBGene00011600(zim-2)
Genomic Alteration: WBGene00011600(zim-2)
Availability: available
Source References: PMID:33377003, PMID:34081106
Synonyms: zim-2(tm574) IV.
Alternate IDs: WB-STRAIN:CA258, CGC_CA258
Notes: Mutagen:UV/TMP|"WBStrain mapped, WBPaper00060819 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061461 added based on AFP_Strain data."|"Weak Him. Produces unhatched eggs."
Proper citation: RRID:WB-STRAIN:WBStrain00004045 Copy
http://www.wormbase.org/db/get?name=WBStrain00004042
Source Database: WormBase (WB)
Affected Genes: WBGene00007664(seb-3)
Genomic Alteration: WBGene00007664(seb-3)
Availability: available
Source References: EMPTY
Synonyms: seb-3(eg696) X.
Alternate IDs: WB-STRAIN:BZ1202, CGC_BZ1202
Notes: This strain is tolerant to acute treatment of ethanol. The severity and incidence of stress-induced tremors are greater than in wild-type. Reference: Jee C, et al. Genes Brain Behav. 2013 Mar;12(2):250-62.
Proper citation: RRID:WB-STRAIN:WBStrain00004042 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
