Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00004967
Source Database: WormBase (WB)
Affected Genes: WBGene00006743(unc-3)
Genomic Alteration: WBGene00006743(unc-3)
Availability: available
Source References: EMPTY
Synonyms: mnDp1 [umnIs25] (X;V)/+ V; unc-3(e151) X.
Alternate IDs: WB-STRAIN:CGC36, CGC_CGC36
Notes: umnIs25 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)]. Pick wild-type GFP+ to maintain. Segregates lethals: homozygous Dp/Dp are lethal. Derived by insertion of myo-2p::GFP transgene into mnDp1 duplication in parental strain SP219 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004967 Copy
http://www.wormbase.org/db/get?name=WBStrain00004965
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: eT1 [umnIs12] III; eT1 V.
Alternate IDs: WB-STRAIN:CGC34, CGC_CGC34
Notes: umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004965 Copy
http://www.wormbase.org/db/get?name=WBStrain00004961
Source Database: WormBase (WB)
Affected Genes: WBGene00001066(dpy-4)|WBGene00006766(unc-30)
Genomic Alteration: WBGene00001066(dpy-4), WBGene00006766(unc-30)
Availability: available
Source References: EMPTY
Synonyms: unc-30(e191) dpy-4(e1166) IV; yDp1 [umnIs19] (IV;V;f).
Alternate IDs: WB-STRAIN:CGC30, CGC_CGC30
Notes: umnIs19 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type GFP+; animals that have lost the Dup are Dpy Unc GFP-. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004961 Copy
http://www.wormbase.org/db/get?name=WBStrain00004962
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: umnIs20 III.
Alternate IDs: WB-STRAIN:CGC31, CGC_CGC31
Notes: umnIs20 [myo-2p::GFP + NeoR, III:518034 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004962 Copy
http://www.wormbase.org/db/get?name=WBStrain00004960
Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006752(unc-13)|WBGene00006778(unc-42)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006752(unc-13), WBGene00006778(unc-42)
Availability: available
Source References: EMPTY
Synonyms: unc-13(e51)/hT1 [umnIs18] I; dpy-11(e224)/hT1 [unc-42(e270)] V.
Alternate IDs: WB-STRAIN:CGC29, CGC_CGC29
Notes: umnIs18 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Dpy Unc, arrested hT1 homozygotes(GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004960 Copy
http://www.wormbase.org/db/get?name=WBStrain00004980
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)
Genomic Alteration: WBGene00000254(bli-4)
Availability: available
Source References: EMPTY
Synonyms: hT2 I; hT2 [bli-4(e937) umnIs38] III.
Alternate IDs: WB-STRAIN:CGC49, CGC_CGC49
Notes: umnIs38 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Homozygous-viable translocation marked with bli-4 and GFP. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004980 Copy
http://www.wormbase.org/db/get?name=WBStrain00004979
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00006744(unc-4)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00006744(unc-4), WBGene00006787(unc-52)
Availability: available
Source References: EMPTY
Synonyms: unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II.
Alternate IDs: WB-STRAIN:CGC48, CGC_CGC48
Notes: umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Hets are WT mKate2+ and segregate WT mKate2+, Unc-4 (no red fluorescence) and paralysed DpyUnc mKate2+ (mnC1). Maintain by picking WT mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain SP127 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004979 Copy
http://www.wormbase.org/db/get?name=WBStrain00004976
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001076(dpy-17)|WBGene00006744(unc-4)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001076(dpy-17), WBGene00006744(unc-4)
Availability: available
Source References: EMPTY
Synonyms: unc-4(e120)/mT1 [umnIs34] II; mT1 [dpy-10(e128)]/dpy-17(e164) III.
Alternate IDs: WB-STRAIN:CGC45, CGC_CGC45
Notes: umnIs34 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004976 Copy
http://www.wormbase.org/db/get?name=WBStrain00004977
Source Database: WormBase (WB)
Affected Genes: WBGene00001070(dpy-8)|WBGene00003056(lon-2)|WBGene00006743(unc-3)
Genomic Alteration: WBGene00001070(dpy-8), WBGene00003056(lon-2), WBGene00006743(unc-3)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678)] I; dpy-8(e1321) unc-3(e151)/szT1 [umnIs35] X.
Alternate IDs: WB-STRAIN:CGC46, CGC_CGC46
Notes: umnIs35 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004977 Copy
http://www.wormbase.org/db/get?name=WBStrain00004970
Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006745(unc-5)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006745(unc-5)
Availability: available
Source References: EMPTY
Synonyms: unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs28] V.
Alternate IDs: WB-STRAIN:CGC39, CGC_CGC39
Notes: umnIs28 [myo-2p::GFP + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004970 Copy
http://www.wormbase.org/db/get?name=WBStrain00004971
Source Database: WormBase (WB)
Affected Genes: WBGene00001070(dpy-8)|WBGene00003056(lon-2)|WBGene00006743(unc-3)
Genomic Alteration: WBGene00001070(dpy-8), WBGene00003056(lon-2), WBGene00006743(unc-3)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678) umnIs29] I; dpy-8(e1321) unc-3(e151)/szT1 X.
Alternate IDs: WB-STRAIN:CGC40, CGC_CGC40
Notes: umnIs29 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-GFP, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004971 Copy
http://www.wormbase.org/db/get?name=WBStrain00004990
Source Database: WormBase (WB)
Affected Genes: WBGene00001077(dpy-18)|WBGene00006782(unc-46)
Genomic Alteration: WBGene00001077(dpy-18), WBGene00006782(unc-46)
Availability: available
Source References: EMPTY
Synonyms: dpy-18(e364)/eT1 III; unc-46(e177)/eT1[umnIs46] V.
Alternate IDs: WB-STRAIN:CGC60, CGC_CGC60
Notes: umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type mKate+, and segregate wild-type mKate2+, Unc-36 mKate+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004990 Copy
http://www.wormbase.org/db/get?name=WBStrain00004991
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Alternate IDs: WB-STRAIN:CGC61, CGC_CGC61
Notes: Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of F36D4.4. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: atgacaatgtctcaagggtccatgtactcccctatatcttccaaacattc Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCTCAATTTATTTGTCATTATTG"
Proper citation: RRID:WB-STRAIN:WBStrain00004991 Copy
http://www.wormbase.org/db/get?name=WBStrain00004907
Source Database: WormBase (WB)
Affected Genes: WBGene00000908(daf-12)|WBGene00000912(daf-16)|WBGene00001609(glp-1)
Genomic Alteration: WBGene00000908(daf-12), WBGene00000912(daf-16), WBGene00001609(glp-1)
Availability: available
Source References: EMPTY
Synonyms: daf-16(mu86) I; glp-1(e2141) III; daf-12(rh61rh411) X; muEx248.
Alternate IDs: WB-STRAIN:CF2278, CGC_CF2278
Notes: Made_by: C Kenyon/J Berman|"muEx248 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less. Pick RFP+/GFP+ animals to maintain."
Proper citation: RRID:WB-STRAIN:WBStrain00004907 Copy
http://www.wormbase.org/db/get?name=WBStrain00004906
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: muEx340.
Alternate IDs: WB-STRAIN:CF2266, CGC_CF2266
Notes: muEx340 [ges-1p::RFP + ges-1p::ins-7]. Intestinal expression of ins-7 shortens lifespan. Pick RFP animals to maintain.
Proper citation: RRID:WB-STRAIN:WBStrain00004906 Copy
http://www.wormbase.org/db/get?name=WBStrain00004989
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00008737(gnrr-7)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00008737(gnrr-7)
Availability: available
Source References: EMPTY
Synonyms: gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Alternate IDs: WB-STRAIN:CGC59, CGC_CGC59
Notes: Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of gnrr-7. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ATATTTATTTAATATATATTTTGTTCTGGTTTAAAGCCGCAAAGTCTTGG Right flanking sequence: AGGGTACCATCAAGCAATGGCATTCTGGTTGCCCTTAAGCATAACAATTG"
Proper citation: RRID:WB-STRAIN:WBStrain00004989 Copy
http://www.wormbase.org/db/get?name=WBStrain00004902
Source Database: WormBase (WB)
Affected Genes: WBGene00000912(daf-16)|WBGene00001609(glp-1)
Genomic Alteration: WBGene00000912(daf-16), WBGene00001609(glp-1)
Availability: available
Source References: EMPTY
Synonyms: daf-16(mu86) I; glp-1(e2141) III; muEx248.
Alternate IDs: WB-STRAIN:CF2247, CGC_CF2247
Notes: Made_by: C Kenyon/J Berman|"muEx248 [daf-16::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less. Pick RFP+/GFP+ animals to maintain."
Proper citation: RRID:WB-STRAIN:WBStrain00004902 Copy
http://www.wormbase.org/db/get?name=WBStrain00004987
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: umnIs47 III.
Alternate IDs: WB-STRAIN:CGC57, CGC_CGC57
Notes: umnIs47 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] III. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004987 Copy
http://www.wormbase.org/db/get?name=WBStrain00004988
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Alternate IDs: WB-STRAIN:CGC58, CGC_CGC58
Notes: Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C54E10.3. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: tctccgcctaaaaaaatatatgtacccccgatgggattcgaacctgtggc Right flanking sequence: GGGTATGCAAAATGACCGCGTTTTCTGTGAATTCATCGTCATGCTTTATT"
Proper citation: RRID:WB-STRAIN:WBStrain00004988 Copy
http://www.wormbase.org/db/get?name=WBStrain00004985
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: umnIs44 II.
Alternate IDs: WB-STRAIN:CGC54, CGC_CGC54
Notes: umnIs44 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004985 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
