Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00005005
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: umnIs59 I.
Alternate IDs: WB-STRAIN:CGC76, CGC_CGC76
Notes: umnIs59 [myo-2p::mKate2 + NeoR, I:6284001(intergenic)] I. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00005005 Copy
http://www.wormbase.org/db/get?name=WBStrain00005004
Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006752(unc-13)|WBGene00006778(unc-42)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006752(unc-13), WBGene00006778(unc-42)
Availability: available
Source References: EMPTY
Synonyms: unc-13(e51)/hT1 [umnIs58] I; dpy-11(e224)/hT1 [unc-42(e270)] V.
Alternate IDs: WB-STRAIN:CGC75, CGC_CGC75
Notes: umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00005004 Copy
http://www.wormbase.org/db/get?name=WBStrain00005021
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006772(unc-36)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61)/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III.
Alternate IDs: WB-STRAIN:CGC92, CGC_CGC92
Notes: umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
Proper citation: RRID:WB-STRAIN:WBStrain00005021 Copy
http://www.wormbase.org/db/get?name=WBStrain00005022
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: umnIs74 X.
Alternate IDs: WB-STRAIN:CGC93, CGC_CGC93
Notes: umnIs74 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] X. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00005022 Copy
http://www.wormbase.org/db/get?name=WBStrain00005020
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: umnIs72 I.
Alternate IDs: WB-STRAIN:CGC91, CGC_CGC91
Notes: umnIs72 [myo-2p::GFP + NeoR, I:6284001 (intergenic)] I. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00005020 Copy
http://www.wormbase.org/db/get?name=WBStrain00005019
Source Database: WormBase (WB)
Affected Genes: WBGene00006743(unc-3)
Genomic Alteration: WBGene00006743(unc-3)
Availability: available
Source References: EMPTY
Synonyms: unc-3(e151) X; mnDp3 [umnIs71] (X;f).
Alternate IDs: WB-STRAIN:CGC90, CGC_CGC90
Notes: No longer available from the CGC|"umnIs71 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)]. Pick wild-type mKate2+ to maintain. Segregates wild-type mKate2+ and Unc mKate2-. Derived by insertion of myo-2p::mKate2 transgene into mnDp3 duplication in parental strain SP123 using CRISPR/Cas9."
Proper citation: RRID:WB-STRAIN:WBStrain00005019 Copy
http://www.wormbase.org/db/get?name=WBStrain00005017
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: tmIn26 [umnIs70] X.
Alternate IDs: WB-STRAIN:CGC88, CGC_CGC88
Notes: Made_by: Emily Lorenz-Mueller|"umnIs70 [myo-2p::GFP + NeoR, X:6745526(intergenic)] X. tmIn26 homozygotes are Lon and Mec. Break points: In(lon-2 mec-10) X. Covered region (Mb) 3.7 (4.7..8.5) Lon Mec. Derived by insertion of myo-2p::GFP transgene into parental strain FX19171 using CRISPR/Cas9."
Proper citation: RRID:WB-STRAIN:WBStrain00005017 Copy
http://www.wormbase.org/db/get?name=WBStrain00005015
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006772(unc-36)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs67] III.
Alternate IDs: WB-STRAIN:CGC86, CGC_CGC86
Notes: umnIs67 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
Proper citation: RRID:WB-STRAIN:WBStrain00005015 Copy
http://www.wormbase.org/db/get?name=WBStrain00005034
Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001263(emb-9)|WBGene00001609(glp-1)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001263(emb-9), WBGene00001609(glp-1), WBGene00006772(unc-36)
Availability: available
Source References: PMID:9166417
Synonyms: unc-36(e251) emb-9(g23cg46)/qC1 [dpy-19(e1259) glp-1(q339)] III.
Alternate IDs: WB-STRAIN:CH1179, CGC_CH1179
Notes: Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;|"Made_by: Malini Gupta"
Proper citation: RRID:WB-STRAIN:WBStrain00005034 Copy
http://www.wormbase.org/db/get?name=WBStrain00005033
Source Database: WormBase (WB)
Affected Genes: WBGene00018943(dgn-2)
Genomic Alteration: WBGene00018943(dgn-2)
Availability: available
Source References: EMPTY
Synonyms: dgn-2(ok209) X.
Alternate IDs: WB-STRAIN:CH123, CGC_CH123
Notes: Animals appear wild type.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00005033 Copy
http://www.wormbase.org/db/get?name=WBStrain00005029
Source Database: WormBase (WB)
Affected Genes: WBGene00003738(nid-1)
Genomic Alteration: WBGene00003738(nid-1)
Availability: available
Source References: PMID:38964319
Synonyms: nid-1(cg118) V.
Alternate IDs: WB-STRAIN:CH118, CGC_CH118
Notes: Made_by: J. Kramer|"Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. In frame deletion, removes amino acids Thr53-Gln693 of NID-1. Homozygous viable and fertile, slightly reduced fertility. mut-2 was removed by outcrossing. nid-1=F54F3.1. Received new stock 1/2004 from Jim Kramer."
Proper citation: RRID:WB-STRAIN:WBStrain00005029 Copy
http://www.wormbase.org/db/get?name=WBStrain00005027
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: hIn1 [umnIs78] I.
Alternate IDs: WB-STRAIN:CGC105, CGC_CGC105
Notes: umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::mKate2 transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00005027 Copy
http://www.wormbase.org/db/get?name=WBStrain00005026
Source Database: WormBase (WB)
Affected Genes: WBGene00003289(mir-61)|WBGene00003514(myo-2)
Genomic Alteration: WBGene00003289(mir-61), WBGene00003514(myo-2)
Availability: available
Source References: EMPTY
Synonyms: mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272]) V.
Alternate IDs: WB-STRAIN:CGC103, CGC_CGC103
Notes: Made_by: Julie Knott & Marcus Vargas|"mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272]) V. Derived by CRE-meditated excision of SEC in parental strain CGC102, leaving myo-2p::wrmScarlet."
Proper citation: RRID:WB-STRAIN:WBStrain00005026 Copy
http://www.wormbase.org/db/get?name=WBStrain00005038
Source Database: WormBase (WB)
Affected Genes: WBGene00000961(dgn-1)
Genomic Alteration: WBGene00000961(dgn-1)
Availability: available
Source References: EMPTY
Synonyms: dgn-1(cg121) X; cgEx308.
Alternate IDs: WB-STRAIN:CH1869, CGC_CH1869
Notes: cgEx308 [dgn-1(+) + dng-1p::GFP + rol-6(su1006)]. Rollers. Pick rollers to maintain. Segregates sterile non-rollers (dgn-1 homozygotes) and fertile rollers (dgn-1 rescued). Rollers can be used to produce cg121/o; cgEx308 males that can mate.|"Made_by: Robert Johnson"
Proper citation: RRID:WB-STRAIN:WBStrain00005038 Copy
http://www.wormbase.org/db/get?name=WBStrain00005039
Source Database: WormBase (WB)
Affected Genes: WBGene00000961(dgn-1)|WBGene00017221(dgn-3)|WBGene00018943(dgn-2)
Genomic Alteration: WBGene00000961(dgn-1), WBGene00017221(dgn-3), WBGene00018943(dgn-2)
Availability: available
Source References: PMID:38177158
Synonyms: dgn-2(ok209) dgn-3(tm1092) dgn-1(cg121) X; cgEx308.
Alternate IDs: WB-STRAIN:CH1878, CGC_CH1878
Notes: cgEx308 [pJK600/dgn-1(+) + pJK602/dng-1p::GFP + rol-6(su1066)]. Rollers. Pick rollers to maintain. Segregates sterile non-rollers (dgn-2 dgn-3 dgn-1 homozygotes) and fertile rollers (dgn-1 rescued). Rollers can be used to produce cg121/o; cgEx308 males that can mate. Triple mutants resemble dgn-1 single mutants; no overt phenotype caused by dgn-2 dgn-3 mutations.
Proper citation: RRID:WB-STRAIN:WBStrain00005039 Copy
http://www.wormbase.org/db/get?name=WBStrain00005100
Source Database: WormBase (WB)
Availability: available
Source References: PMID:9751195
Synonyms: Punc-54::human Amyloid beta 1-42; mtl-2::gfp
Alternate IDs: WB-STRAIN:CL2120, CGC_CL2120
Notes: dvIs14 [(pCL12) unc-54::beta 1-42 + (pCL26) mtl-2::GFP]. mtl-2::GFP produces strong constitutive intestinal expression of GFP at all developmental stages. Expresses human AB peptide and accumulates B-amyloid fibrils. AB toxicity enhanced at higher temperatures.|"[2020-08-03T20:28:08.764Z WBPerson324] Ressurect Strain: Genotype: Punc-54::human Amyloid beta 1-42; mtl-2::gfp"
Proper citation: RRID:WB-STRAIN:WBStrain00005100 Copy
http://www.wormbase.org/db/get?name=WBStrain00005061
Source Database: WormBase (WB)
Affected Genes: WBGene00004804(skn-1)
Genomic Alteration: WBGene00004804(skn-1)
Availability: available
Source References: EMPTY
Synonyms: dvIs19 III; skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V).
Alternate IDs: WB-STRAIN:CL691, CGC_CL691
Notes: dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.|"Mutagen:Gamma rays"
Proper citation: RRID:WB-STRAIN:WBStrain00005061 Copy
http://www.wormbase.org/db/get?name=WBStrain00005062
Source Database: WormBase (WB)
Affected Genes: WBGene00004397(rol-6)|WBGene00004879(smg-1)
Genomic Alteration: WBGene00004397(rol-6), WBGene00004879(smg-1)
Availability: available
Source References: PMID:32966472, PMID:37726773, PMID:38983916
Synonyms: smg-1(cc546) I; rol-6(su1006) II.
Alternate IDs: WB-STRAIN:CL802, CGC_CL802
Notes: Rollers. Maintain under normal conditions. Standard control for CL4176; originally used CL1175 as the control, but subsequently it was found that CL1175 can produce some A-Beta. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Supplementary_genotype [smg-1(cc546) I; rol-6(su1006) II]"|"WBStrain provided so WBPaper00059477 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005062 Copy
http://www.wormbase.org/db/get?name=WBStrain00005059
Source Database: WormBase (WB)
Affected Genes: WBGene00005157(srf-8)
Genomic Alteration: WBGene00005157(srf-8)
Availability: available
Source References: PMID:1516818
Synonyms: srf-8(dv38) V.
Alternate IDs: WB-STRAIN:CL264, CGC_CL264
Notes: Animals are somewhat smaller than WT. Often have protuding vulva. Unc(slow moving and non-sinusoidal body posture). Egl. Males are infertile and Mab. Ectopic surface binding of lectins WGA and SBA.
Proper citation: RRID:WB-STRAIN:WBStrain00005059 Copy
http://www.wormbase.org/db/get?name=WBStrain00005199
Source Database: WormBase (WB)
Affected Genes: WBGene00006808(unc-76)
Genomic Alteration: WBGene00006808(unc-76)
Availability: available
Source References: EMPTY
Synonyms: unc-76(e911) V; smIs380.
Alternate IDs: WB-STRAIN:CU9087, CGC_CU9087
Notes: Made_by: Jim Mapes|"Mutagen:Gamma rays"|"smIs380 [tra-2::GFP + unc-76(+)]. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press."
Proper citation: RRID:WB-STRAIN:WBStrain00005199 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
