Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
CGC76 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005005 | Caenorhabditis elegans | umnIs59 I. | umnIs59 [myo-2p::mKate2 + NeoR, I:6284001(intergenic)] I. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9. | WB-STRAIN:WBStrain00005005 | WormBase (WB) | WB | available | WB-STRAIN:CGC76, CGC_CGC76 | 2026-08-01 10:11:34 | 0 | |||||
|
CGC75 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005004 | Caenorhabditis elegans | unc-13(e51)/hT1 [umnIs58] I; dpy-11(e224)/hT1 [unc-42(e270)] V. | umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9. | WBGene00001073(dpy-11)|WBGene00006752(unc-13)|WBGene00006778(unc-42) | WBGene00001073(dpy-11), WBGene00006752(unc-13), WBGene00006778(unc-42) | WB-STRAIN:WBStrain00005004 | WormBase (WB) | WB | available | WB-STRAIN:CGC75, CGC_CGC75 | 2026-08-01 10:11:34 | 0 | |||
|
CGC92 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005021 | Caenorhabditis elegans | dpy-5(e61)/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. | umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] | WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006772(unc-36) | WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006772(unc-36) | WB-STRAIN:WBStrain00005021 | WormBase (WB) | WB | available | WB-STRAIN:CGC92, CGC_CGC92 | 2026-08-01 10:11:34 | 0 | |||
|
CGC93 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005022 | Caenorhabditis elegans | umnIs74 X. | umnIs74 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] X. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9. | WB-STRAIN:WBStrain00005022 | WormBase (WB) | WB | available | WB-STRAIN:CGC93, CGC_CGC93 | 2026-08-01 10:11:34 | 0 | |||||
|
CGC91 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005020 | Caenorhabditis elegans | umnIs72 I. | umnIs72 [myo-2p::GFP + NeoR, I:6284001 (intergenic)] I. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9. | WB-STRAIN:WBStrain00005020 | WormBase (WB) | WB | available | WB-STRAIN:CGC91, CGC_CGC91 | 2026-08-01 10:11:34 | 0 | |||||
|
CGC90 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005019 | Caenorhabditis elegans | unc-3(e151) X; mnDp3 [umnIs71] (X;f). | No longer available from the CGC|"umnIs71 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)]. Pick wild-type mKate2+ to maintain. Segregates wild-type mKate2+ and Unc mKate2-. Derived by insertion of myo-2p::mKate2 transgene into mnDp3 duplication in parental strain SP123 using CRISPR/Cas9." | WBGene00006743(unc-3) | WBGene00006743(unc-3) | WB-STRAIN:WBStrain00005019 | WormBase (WB) | WB | available | WB-STRAIN:CGC90, CGC_CGC90 | 2026-08-01 10:11:34 | 0 | |||
|
CGC88 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005017 | Caenorhabditis elegans | tmIn26 [umnIs70] X. | Made_by: Emily Lorenz-Mueller|"umnIs70 [myo-2p::GFP + NeoR, X:6745526(intergenic)] X. tmIn26 homozygotes are Lon and Mec. Break points: In(lon-2 mec-10) X. Covered region (Mb) 3.7 (4.7..8.5) Lon Mec. Derived by insertion of myo-2p::GFP transgene into parental strain FX19171 using CRISPR/Cas9." | WB-STRAIN:WBStrain00005017 | WormBase (WB) | WB | available | WB-STRAIN:CGC88, CGC_CGC88 | 2026-08-01 10:11:34 | 0 | |||||
|
CGC86 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005015 | Caenorhabditis elegans | dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs67] III. | umnIs67 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] | WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006772(unc-36) | WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006772(unc-36) | WB-STRAIN:WBStrain00005015 | WormBase (WB) | WB | available | WB-STRAIN:CGC86, CGC_CGC86 | 2026-08-01 10:11:34 | 0 | |||
|
CH1179 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005034 | Caenorhabditis elegans | unc-36(e251) emb-9(g23cg46)/qC1 [dpy-19(e1259) glp-1(q339)] III. | Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;|"Made_by: Malini Gupta" | WBGene00001078(dpy-19)|WBGene00001263(emb-9)|WBGene00001609(glp-1)|WBGene00006772(unc-36) | WBGene00001078(dpy-19), WBGene00001263(emb-9), WBGene00001609(glp-1), WBGene00006772(unc-36) | WB-STRAIN:WBStrain00005034 | WormBase (WB) | WB | available | PMID:9166417 | WB-STRAIN:CH1179, CGC_CH1179 | 2026-08-01 10:11:35 | 0 | ||
|
CH123 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005033 | Caenorhabditis elegans | dgn-2(ok209) X. | Animals appear wild type.|"Mutagen:UV/TMP" | WBGene00018943(dgn-2) | WBGene00018943(dgn-2) | WB-STRAIN:WBStrain00005033 | WormBase (WB) | WB | available | WB-STRAIN:CH123, CGC_CH123 | 2026-08-01 10:11:35 | 0 | |||
|
CH118 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005029 | Caenorhabditis elegans | nid-1(cg118) V. | Made_by: J. Kramer|"Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. In frame deletion, removes amino acids Thr53-Gln693 of NID-1. Homozygous viable and fertile, slightly reduced fertility. mut-2 was removed by outcrossing. nid-1=F54F3.1. Received new stock 1/2004 from Jim Kramer." | WBGene00003738(nid-1) | WBGene00003738(nid-1) | WB-STRAIN:WBStrain00005029 | WormBase (WB) | WB | available | PMID:38964319 | WB-STRAIN:CH118, CGC_CH118 | 2026-08-01 10:11:35 | 1 | ||
|
CGC105 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005027 | Caenorhabditis elegans | hIn1 [umnIs78] I. | umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::mKate2 transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9. | WB-STRAIN:WBStrain00005027 | WormBase (WB) | WB | available | WB-STRAIN:CGC105, CGC_CGC105 | 2026-08-01 10:11:35 | 0 | |||||
|
CGC103 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005026 | Caenorhabditis elegans | mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272]) V. | Made_by: Julie Knott & Marcus Vargas|"mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272]) V. Derived by CRE-meditated excision of SEC in parental strain CGC102, leaving myo-2p::wrmScarlet." | WBGene00003289(mir-61)|WBGene00003514(myo-2) | WBGene00003289(mir-61), WBGene00003514(myo-2) | WB-STRAIN:WBStrain00005026 | WormBase (WB) | WB | available | WB-STRAIN:CGC103, CGC_CGC103 | 2026-08-01 10:11:35 | 0 | |||
|
CH1869 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005038 | Caenorhabditis elegans | dgn-1(cg121) X; cgEx308. | cgEx308 [dgn-1(+) + dng-1p::GFP + rol-6(su1006)]. Rollers. Pick rollers to maintain. Segregates sterile non-rollers (dgn-1 homozygotes) and fertile rollers (dgn-1 rescued). Rollers can be used to produce cg121/o; cgEx308 males that can mate.|"Made_by: Robert Johnson" | WBGene00000961(dgn-1) | WBGene00000961(dgn-1) | WB-STRAIN:WBStrain00005038 | WormBase (WB) | WB | available | WB-STRAIN:CH1869, CGC_CH1869 | 2026-08-01 10:11:35 | 0 | |||
|
CH1878 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005039 | Caenorhabditis elegans | dgn-2(ok209) dgn-3(tm1092) dgn-1(cg121) X; cgEx308. | cgEx308 [pJK600/dgn-1(+) + pJK602/dng-1p::GFP + rol-6(su1066)]. Rollers. Pick rollers to maintain. Segregates sterile non-rollers (dgn-2 dgn-3 dgn-1 homozygotes) and fertile rollers (dgn-1 rescued). Rollers can be used to produce cg121/o; cgEx308 males that can mate. Triple mutants resemble dgn-1 single mutants; no overt phenotype caused by dgn-2 dgn-3 mutations. | WBGene00000961(dgn-1)|WBGene00017221(dgn-3)|WBGene00018943(dgn-2) | WBGene00000961(dgn-1), WBGene00017221(dgn-3), WBGene00018943(dgn-2) | WB-STRAIN:WBStrain00005039 | WormBase (WB) | WB | available | PMID:38177158 | WB-STRAIN:CH1878, CGC_CH1878 | 2026-08-01 10:11:35 | 1 | ||
|
CL2120 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005100 | Caenorhabditis elegans | Punc-54::human Amyloid beta 1-42; mtl-2::gfp | dvIs14 [(pCL12) unc-54::beta 1-42 + (pCL26) mtl-2::GFP]. mtl-2::GFP produces strong constitutive intestinal expression of GFP at all developmental stages. Expresses human AB peptide and accumulates B-amyloid fibrils. AB toxicity enhanced at higher temperatures.|"[2020-08-03T20:28:08.764Z WBPerson324] Ressurect Strain: Genotype: Punc-54::human Amyloid beta 1-42; mtl-2::gfp" | WB-STRAIN:WBStrain00005100 | WormBase (WB) | WB | available | PMID:9751195 | WB-STRAIN:CL2120, CGC_CL2120 | 2026-08-01 10:11:36 | 0 | ||||
|
CL691 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005061 | Caenorhabditis elegans | dvIs19 III; skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V). | dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.|"Mutagen:Gamma rays" | WBGene00004804(skn-1) | WBGene00004804(skn-1) | WB-STRAIN:WBStrain00005061 | WormBase (WB) | WB | available | WB-STRAIN:CL691, CGC_CL691 | 2026-08-01 10:11:35 | 0 | |||
|
CL802 Resource Report Resource Website 10+ mentions |
RRID:WB-STRAIN:WBStrain00005062 | Caenorhabditis elegans | smg-1(cc546) I; rol-6(su1006) II. | Rollers. Maintain under normal conditions. Standard control for CL4176; originally used CL1175 as the control, but subsequently it was found that CL1175 can produce some A-Beta. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Supplementary_genotype [smg-1(cc546) I; rol-6(su1006) II]"|"WBStrain provided so WBPaper00059477 paper added based on AFP_Strain data." | WBGene00004397(rol-6)|WBGene00004879(smg-1) | WBGene00004397(rol-6), WBGene00004879(smg-1) | WB-STRAIN:WBStrain00005062 | WormBase (WB) | WB | available | PMID:32966472 PMID:37726773 PMID:38983916 |
WB-STRAIN:CL802, CGC_CL802 | 2026-08-01 10:11:35 | 11 | ||
|
CL264 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005059 | Caenorhabditis elegans | srf-8(dv38) V. | Animals are somewhat smaller than WT. Often have protuding vulva. Unc(slow moving and non-sinusoidal body posture). Egl. Males are infertile and Mab. Ectopic surface binding of lectins WGA and SBA. | WBGene00005157(srf-8) | WBGene00005157(srf-8) | WB-STRAIN:WBStrain00005059 | WormBase (WB) | WB | available | PMID:1516818 | WB-STRAIN:CL264, CGC_CL264 | 2026-08-01 10:11:35 | 0 | ||
|
CU9087 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005199 | Caenorhabditis elegans | unc-76(e911) V; smIs380. | Made_by: Jim Mapes|"Mutagen:Gamma rays"|"smIs380 [tra-2::GFP + unc-76(+)]. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press." | WBGene00006808(unc-76) | WBGene00006808(unc-76) | WB-STRAIN:WBStrain00005199 | WormBase (WB) | WB | available | WB-STRAIN:CU9087, CGC_CU9087 | 2026-08-01 10:11:37 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
