Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
CU6493 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005197 | Caenorhabditis elegans | eef-1A.1(q145) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Heterozygotes are WT and GFP+. Segregate non-GFP steriles (q145 homozygotes). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. | WBGene00000254(bli-4)|WBGene00001168(eef-1A.1) | WBGene00000254(bli-4), WBGene00001168(eef-1A.1) | WB-STRAIN:WBStrain00005197 | WormBase (WB) | WB | available | WB-STRAIN:CU6493, CGC_CU6493 | 2026-08-01 10:11:37 | 0 | |||
|
CU6102 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005195 | Caenorhabditis elegans | skr-1(sm151) I; unc-76(e911) V. | Mutagen:UV/TMP|"sm151 is a semi-dominant allele of skr-1. Maintain under normal conditions. Reference: Killian DJ, et al. (2008) Dev Biol. 322(2):322-31." | WBGene00004807(skr-1)|WBGene00006808(unc-76) | WBGene00004807(skr-1), WBGene00006808(unc-76) | WB-STRAIN:WBStrain00005195 | WormBase (WB) | WB | available | WB-STRAIN:CU6102, CGC_CU6102 | 2026-08-01 10:11:37 | 0 | |||
|
CU2945 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005193 | Caenorhabditis elegans | scrm-1(tm805) I. | Made_by: X. Wang & D. Xue|"Mild defect in cell corpse engulfment."|"Mutagen:UV/TMP"|"WBStrain provided so WBPaper00061198 paper added based on AFP_Strain data." | WBGene00011935(scrm-1) | WBGene00011935(scrm-1) | WB-STRAIN:WBStrain00005193 | WormBase (WB) | WB | available | PMID:33759761 | WB-STRAIN:CU2945, CGC_CU2945 | 2026-08-01 10:11:37 | 0 | ||
|
CU1546 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005190 | Caenorhabditis elegans | smIs34. | Mutagen:Gamma rays|"smIs34 [ced-1p::ced-1::GFP + rol-6(su1006)]. Maintain under standard conditions. Reference: Zou W, et al., (2009) PLoS Genet. 5(10):e1000679." | WB-STRAIN:WBStrain00005190 | WormBase (WB) | WB | available | PMID:36774344 PMID:37118512 PMID:37577954 |
WB-STRAIN:CU1546, CGC_CU1546 | 2026-08-01 10:11:37 | 6 | ||||
|
CL2355 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005106 | Caenorhabditis elegans | EMPTY | Associated protein: Human A peptide|"dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]"|"Mutagen:Gamma rays"|"Transgene expression: Inducible pan-neuronal + intestine (marker)"|"[2020-08-03T20:49:03.516Z WBPerson324] Ressurect Strain: Genotype: smg-1(cc546); pCL45 [Psnb-1::human Amyloid beta 1-42::3' UTR (long); Pmtl-2::GFP]" | WBGene00004879(smg-1) | WBGene00004879(smg-1) | WB-STRAIN:WBStrain00005106 | WormBase (WB) | WB | available | PMID:31797327 PMID:32966472 PMID:33466350 PMID:35018947 PMID:37549461 PMID:38274404 PMID:38500791 PMID:38983916 PMID:39212733 |
WB-STRAIN:CL2355, CGC_CL2355 | 2026-08-01 10:11:36 | 7 | ||
|
CL2331 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005104 | Caenorhabditis elegans | dvIs37. | dvIs37 [myo-3p::GFP::A-Beta (3-42) + rol-6(su1006)]. Maintain at 16C. Roller. Diffuse and aggregated GFP expression in body wall muscle. Low brood size. Sicker at higher temperatures (e.g. 25C). Reference: Link CD, et al. (2008) Neurobiology of Disease,32(3):420-5.|"expresses the human A3-42 peptide fused to green fluorescent protein (GFP) in its body-wall muscle cells"|"Mutagen:Gamma radiation" | WB-STRAIN:WBStrain00005104 | WormBase (WB) | WB | available | PMID:35018947 PMID:37549461 PMID:37239029 PMID:38983916 |
WB-STRAIN:CL2331, CGC_CL2331 | 2026-08-01 10:11:36 | 4 | ||||
|
CL2337 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005105 | Caenorhabditis elegans | smg-1(cc546) I; dvIs38. | dvIs38 [myo-3p::GFP::degron::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Rollers. Temperature-dependent expression of aggregating GFP in body wall muscle (weak at 16C, strong at 25C). Animals become paralyzed if upshifted as larvae to 25C due to expression of aggregating GFP. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Mutagen:Gamma radiation" | WBGene00004879(smg-1) | WBGene00004879(smg-1) | WB-STRAIN:WBStrain00005105 | WormBase (WB) | WB | available | WB-STRAIN:CL2337, CGC_CL2337 | 2026-08-01 10:11:36 | 0 | |||
|
CL2166 Resource Report Resource Website 10+ mentions |
RRID:WB-STRAIN:WBStrain00005102 | Caenorhabditis elegans | dvIs19 [(pAF15)gst-4p::GFP::NLS] III. | dvIs19 [(pAF15)gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP.|"Reference WBPaper00054805 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00057197 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00057259 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00058621 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype (dvIs19[pAF15(gst-4::GFP::NLS)])"|"Supplementary_genotype dvIs19 [(pAF15)gst-4p::GFP::NLS] III"|"Supplementary_genotype dvIs19[(pAF15)gst-4p::GFP::NLS]"|"Supplementary_genotype gst-4::GFP dvIs19 [(pAF15)gst-4p::GFP::NLS] III"|"Supplementary_genotype gst-4p::GFP"|"WBStrain mapped, WBPaper00059548 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060449 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060456 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060486 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060545 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060669 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060692 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060778 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060797 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060840 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060896 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060924 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060976 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061045 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061159 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061220 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061236 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061385 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061436 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061452 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061495 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061547 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061584 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061641 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061671 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061869 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061871 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061890 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061895 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061902 added based on AFP_Strain data."|"WBStrain provided so WBPaper00059545 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060797 paper added based on AFP_Strain data." | WBGene00001752(gst-4) | WBGene00001752(gst-4) | WB-STRAIN:WBStrain00005102 | WormBase (WB) | WB | available | PMID:12757851 PMID:29956725 PMID:31409866 PMID:31432005 PMID:31510078 PMID:31717869 PMID:31735670 PMID:32294300 PMID:32600387 PMID:33008901 PMID:32163353 PMID:33471780 PMID:33789349 PMID:33809299 PMID:33883621 PMID:34505574 PMID:35602005 PMID:36791646 PMID:37099597 PMID:37416472 PMID:37427543 PMID:37488107 PMID:37549461 PMID:37606250 PMID:37726773 PMID:37751046 PMID:37902464 PMID:37910615 PMID:38632209 PMID:38799567 PMID:38754743 PMID:38889876 PMID:38983916 PMID:38991033 PMID:39169052 PMID:39164296 PMID:39264947 PMID:39097626 PMID:39420966 PMID:39561954 PMID:39560153 |
WB-STRAIN:CL2166, CGC_CL2166 | 2026-08-01 10:11:36 | 32 | ||
|
CL2179 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005103 | Caenorhabditis elegans | smg-1(cc546) I; dvIs179. | dvIs179 [myo-3p::GFP::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Superficially wild-type Roller; expression of GFP in body wall muscles increases with temperature. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Mutagen:Gamma radiation" | WBGene00004879(smg-1) | WBGene00004879(smg-1) | WB-STRAIN:WBStrain00005103 | WormBase (WB) | WB | available | WB-STRAIN:CL2179, CGC_CL2179 | 2026-08-01 10:11:36 | 0 | |||
|
COP1863 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005122 | Caenorhabditis elegans | goa-1(knu751) I. | Hyperactive, protruding vulva. knu751 is an A221D point mutation associated with GNAO1-associated epileptic encephalopathy. This strain may not be distributed to commercial or for-profit entities. Please contact [email protected] for more information.|"Made_by: NemaMetrix"|"WBStrain provided so WBPaper00062031 paper added based on AFP_Strain data." | WBGene00001648(goa-1) | WBGene00001648(goa-1) | WB-STRAIN:WBStrain00005122 | WormBase (WB) | WB | available | PMID:34622282 | WB-STRAIN:COP1863, CGC_COP1863 | 2026-08-01 10:11:36 | 0 | ||
|
COP1918 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005123 | Caenorhabditis elegans | rskn-1(knu796) I. | Made_by: NemaMetrix|"Superficially wild-type. knu796 is a K216E point mutation mimicking a patient allele associated with Coffin-Lowry syndrome. This strain may not be distributed to commercial or for-profit entities. Please contact [email protected] for more information." | WBGene00011352(rskn-1) | WBGene00011352(rskn-1) | WB-STRAIN:WBStrain00005123 | WormBase (WB) | WB | available | WB-STRAIN:COP1918, CGC_COP1918 | 2026-08-01 10:11:36 | 0 | |||
|
COP677 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005120 | Caenorhabditis elegans | ncr-1(knu4) X. | Cholesterol-sensitive. Smaller broods and sizes upon serial cholesterol deprivation. This strain may not be distributed to commercial or for-profit entities. Please contact [email protected] for more information.|"Made_by: NemaMetrix" | WBGene00003561(ncr-1) | WBGene00003561(ncr-1) | WB-STRAIN:WBStrain00005120 | WormBase (WB) | WB | available | WB-STRAIN:COP677, CGC_COP677 | 2026-08-01 10:11:36 | 0 | |||
|
COP262 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005119 | Caenorhabditis elegans | unc-119(ed3) III; knuSi221. | fib-1 translational marker|"knuSi221 [fib-1p::fib-1(genomic)::eGFP::fib-1 3' UTR + unc-119(+)]. Single copy insertion. fib-1 promoter, genomic sequence, and 3'UTR was inserted into pCFJ151 (ttTi5606) targeting vector and inserted into ttTi5605. Allen AK, Nesmith JE, and A Golden. 2014 G3:4(12)2329-43."|"Made_by: Knudra Transgenics" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00005119 | WormBase (WB) | WB | available | PMID:37039075 PMID:37118512 |
WB-STRAIN:COP262, CGC_COP262 | 2026-08-01 10:11:36 | 3 | ||
|
CL6180 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005115 | Caenorhabditis elegans | smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. | dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Mutagen:Gamma radiation" | WBGene00004804(skn-1)|WBGene00004879(smg-1) | WBGene00004804(skn-1), WBGene00004879(smg-1) | WB-STRAIN:WBStrain00005115 | WormBase (WB) | WB | available | WB-STRAIN:CL6180, CGC_CL6180 | 2026-08-01 10:11:36 | 0 | |||
|
CL6049 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005114 | Caenorhabditis elegans | dvIs62 X. | Associated protein: Human TDP-43|"dvIs62 [snb-1p::hTDP-43/3' long UTR + mtl-2p::GFP] X. Temperature-sensitive. Maintain at 16 to minimize selection against transgene. Uncoordinated from hatching; phenotype is stronger at higher temperatures. Intestinal GFP expression. Reference: Ash PE, et al. Hum Mol Genet. 2010 Aug 15;19(16):3206-18."|"Mutagen:UV/TMP"|"Supplementary_genotype dvIs62 [snb-1p::hTDP-43/3'long UTR + mtl-2p::GFP] X"|"Transgene expression: Inducible pan-neuronal + intestine (marker)" | WB-STRAIN:WBStrain00005114 | WormBase (WB) | WB | available | PMID:37957360 PMID:39212733 |
WB-STRAIN:CL6049, CGC_CL6049 | 2026-08-01 10:11:36 | 1 | ||||
|
COP2008 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005126 | Caenorhabditis elegans | agl-1(knu864) II. | Made_by: NemaMetrix|"Superficially wild-type. knu864 is a S1444R point mutation associated with Cori Disease. This strain may not be distributed to commercial or for-profit entities. Please contact [email protected] for more information." | WBGene00011050(agl-1) | WBGene00011050(agl-1) | WB-STRAIN:WBStrain00005126 | WormBase (WB) | WB | available | WB-STRAIN:COP2008, CGC_COP2008 | 2026-08-01 10:11:36 | 0 | |||
|
COP2002 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005124 | Caenorhabditis elegans | K09E4.4(knu858) II. | knu858 is a Y146C point mutation representative of a patient mutation associated with MPSIIIB disease. This strain may not be distributed to commercial or for-profit entities. Please contact [email protected] for more information.|"Made_by: NemaMetrix" | WB-STRAIN:WBStrain00005124 | WormBase (WB) | WB | available | WB-STRAIN:COP2002, CGC_COP2002 | 2026-08-01 10:11:36 | 0 | |||||
|
CS67 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005144 | Caenorhabditis elegans | sma-9(qc3) X. | Small body size. Crumpled spicules. Male ray 8-9 fusion. | WBGene00004862(sma-9) | WBGene00004862(sma-9) | WB-STRAIN:WBStrain00005144 | WormBase (WB) | WB | available | WB-STRAIN:CS67, CGC_CS67 | 2026-08-01 10:11:36 | 0 | |||
|
CS119 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005145 | Caenorhabditis elegans | sma-3(wk30) III; him-5(e1490) V; qcEx24. | qcEx24 [GFP::sma-3 + rol-6(su1006)]. Rollers. Pick rollers to maintain. Array rescues body size phenotype. Reference: Wang J, Tokarz R, Savage-Dunn C. Development. 2002 Nov;129(21):4989-98. | WBGene00001864(him-5)|WBGene00004857(sma-3) | WBGene00001864(him-5), WBGene00004857(sma-3) | WB-STRAIN:WBStrain00005145 | WormBase (WB) | WB | available | WB-STRAIN:CS119, CGC_CS119 | 2026-08-01 10:11:36 | 1 | |||
|
CS1 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005143 | Caenorhabditis elegans | sma-9(wk55) X. | Small body size. Crumpled spicules. Male ray 8-9 fusion. | WBGene00004862(sma-9) | WBGene00004862(sma-9) | WB-STRAIN:WBStrain00005143 | WormBase (WB) | WB | available | WB-STRAIN:CS1, CGC_CS1 | 2026-08-01 10:11:36 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
