Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00005388
Source Database: WormBase (WB)
Affected Genes: WBGene00001553(gcy-33)
Genomic Alteration: WBGene00001553(gcy-33)
Availability: available
Source References: EMPTY
Synonyms: gcy-33(ok232) V.
Alternate IDs: WB-STRAIN:CZ3715, CGC_CZ3715
Notes: 1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00005388 Copy
http://www.wormbase.org/db/get?name=WBStrain00005389
Source Database: WormBase (WB)
Affected Genes: WBGene00004215(ptp-3)
Genomic Alteration: WBGene00004215(ptp-3)
Availability: available
Source References: PMID:33147118
Synonyms: ptp-3(mu256) II.
Alternate IDs: WB-STRAIN:CZ3761, CGC_CZ3761
Notes: Low penetrance tail Vab and embryonic lethality.|"WBStrain mapped, WBPaper00060580 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005389 Copy
http://www.wormbase.org/db/get?name=WBStrain00005321
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: ggr-2(lf62) X.
Alternate IDs: WB-STRAIN:CX12708, CGC_CX12708
Notes: Made_by: Steven Flavell|"Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35."
Proper citation: RRID:WB-STRAIN:WBStrain00005321 Copy
http://www.wormbase.org/db/get?name=WBStrain00005316
Source Database: WormBase (WB)
Availability: available
Source References: PMID:31422888
Synonyms: kyIR9 (X: ~4745910 - ~4927296, N2>CB4856) X.
Alternate IDs: WB-STRAIN:CX11400, CGC_CX11400
Notes: kyIR9 [X: ~4745910 - ~4927296, N2>CB4856] X. LG X contains N2 from ~4745910 - ~4927296; the rest is from CB4856. QX9 was crossed to CB4856; a recombinant F2 with N2 npr-1 and CB4856 tyra-3 was isolated. Its progeny was back-crossed to CB4856 8 times, picking npr-1 hets each round prior to homozygosing.
Proper citation: RRID:WB-STRAIN:WBStrain00005316 Copy
http://www.wormbase.org/db/get?name=WBStrain00005311
Source Database: WormBase (WB)
Availability: available
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:CX11315, CGC_CX11315
Notes: Made_by: A. Sivasundar|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90."
Proper citation: RRID:WB-STRAIN:WBStrain00005311 Copy
http://www.wormbase.org/db/get?name=WBStrain00005331
Source Database: WormBase (WB)
Affected Genes: WBGene00021983(npr-5)
Genomic Alteration: WBGene00021983(npr-5)
Availability: available
Source References: PMID:38446031, PMID:38573858
Synonyms: npr-5(ok1583) V.
Alternate IDs: WB-STRAIN:CX14394, CGC_CX14394
Notes: Derived by outcrossing RB1393 five times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.|"Made_by: Steven Flavell"
Proper citation: RRID:WB-STRAIN:WBStrain00005331 Copy
http://www.wormbase.org/db/get?name=WBStrain00005330
Source Database: WormBase (WB)
Affected Genes: WBGene00015735(pdfr-1)
Genomic Alteration: WBGene00015735(pdfr-1)
Availability: available
Source References: PMID:32510332, PMID:38573858
Synonyms: pdfr-1(ok3425) III.
Alternate IDs: WB-STRAIN:CX14295, CGC_CX14295
Notes: Decreased locomotion on food. Derived by outcrossing VC2609 five times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.|"Made_by: Steven Flavell"|"WBStrain mapped, WBPaper00059778 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005330 Copy
http://www.wormbase.org/db/get?name=WBStrain00005327
Source Database: WormBase (WB)
Affected Genes: WBGene00006411(octr-1)
Genomic Alteration: WBGene00006411(octr-1)
Availability: available
Source References: PMID:32847964
Synonyms: octr-1(ok371) X.
Alternate IDs: WB-STRAIN:CX13079, CGC_CX13079
Notes: Derived by outcrossing VC224 four times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.|"Made_by: Steven Flavell"|"WBStrain provided so WBPaper00060134 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005327 Copy
http://www.wormbase.org/db/get?name=WBStrain00005325
Source Database: WormBase (WB)
Affected Genes: WBGene00002131(inx-9)
Genomic Alteration: WBGene00002131(inx-9)
Availability: available
Source References: PMID:38573858
Synonyms: inx-9(ok1502) IV.
Alternate IDs: WB-STRAIN:CX12726, CGC_CX12726
Notes: Increased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.|"Made_by: Steven Flavell"
Proper citation: RRID:WB-STRAIN:WBStrain00005325 Copy
http://www.wormbase.org/db/get?name=WBStrain00005341
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: bvIs6.
Alternate IDs: WB-STRAIN:CY577, CGC_CY577
Notes: bvIs6 [cat-4p::GFP + gcy-7p::GFP]. GFP localized to intestine, neurons and hypodermis in adults. GFP localized to neurons and seam cells in dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369.|"Made_by: C Wolkow & W Iser"
Proper citation: RRID:WB-STRAIN:WBStrain00005341 Copy
http://www.wormbase.org/db/get?name=WBStrain00005339
Source Database: WormBase (WB)
Affected Genes: WBGene00000090(age-1)|WBGene00001072(dpy-10)|WBGene00005016(sqt-1)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00000090(age-1), WBGene00001072(dpy-10), WBGene00005016(sqt-1), WBGene00006787(unc-52)
Availability: available
Source References: EMPTY
Synonyms: sqt-1(sc13) age-1(mg109)/mnC1 [dpy-10(e128) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:CY401, CGC_CY401
Notes: Heterozygotes are WT and segregate WT, DpyUncs and Sqt. age-1(mg109) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive). age-1(mg109) homozygous animals that are maternally rescued for dauer formation are long-lived.|"Made_by: Ruvkun Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00005339 Copy
http://www.wormbase.org/db/get?name=WBStrain00005337
Source Database: WormBase (WB)
Affected Genes: WBGene00000090(age-1)|WBGene00003965(pdk-1)|WBGene00005016(sqt-1)
Genomic Alteration: WBGene00000090(age-1), WBGene00003965(pdk-1), WBGene00005016(sqt-1)
Availability: available
Source References: EMPTY
Synonyms: sqt-1(sc13) age-1(mg109) II; pdk-1(mg261) X.
Alternate IDs: WB-STRAIN:CY399, CGC_CY399
Notes: Sqt phenotype. The pdk-1(mg261) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg261 is an activating missense mutation Ala447Val.
Proper citation: RRID:WB-STRAIN:WBStrain00005337 Copy
http://www.wormbase.org/db/get?name=WBStrain00005338
Source Database: WormBase (WB)
Affected Genes: WBGene00000090(age-1)|WBGene00000102(akt-1)|WBGene00005016(sqt-1)
Genomic Alteration: WBGene00000090(age-1), WBGene00000102(akt-1), WBGene00005016(sqt-1)
Availability: available
Source References: EMPTY
Synonyms: sqt-1(sc13) age-1(mg109) II; akt-1(mg247) V.
Alternate IDs: WB-STRAIN:CY400, CGC_CY400
Notes: Sqt phenotype. The akt-1(mg247) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg247 is an activating missense mutation Ala149Thr.
Proper citation: RRID:WB-STRAIN:WBStrain00005338 Copy
http://www.wormbase.org/db/get?name=WBStrain00005333
Source Database: WormBase (WB)
Affected Genes: WBGene00000090(age-1)|WBGene00005016(sqt-1)
Genomic Alteration: WBGene00000090(age-1), WBGene00005016(sqt-1)
Availability: available
Source References: EMPTY
Synonyms: sqt-1(sc13) age-1(mg44) II; bvIs2.
Alternate IDs: WB-STRAIN:CY251, CGC_CY251
Notes: bvIs2 contains [ric-19p::age-1(cDNA)::myc::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs2 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GCA CAG TTT TAC GAA AGG AAC-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
Proper citation: RRID:WB-STRAIN:WBStrain00005333 Copy
http://www.wormbase.org/db/get?name=WBStrain00005334
Source Database: WormBase (WB)
Affected Genes: WBGene00000090(age-1)|WBGene00005016(sqt-1)
Genomic Alteration: WBGene00000090(age-1), WBGene00005016(sqt-1)
Availability: available
Source References: EMPTY
Synonyms: sqt-1(sc13) age-1(mg44) II; bvIs1.
Alternate IDs: WB-STRAIN:CY262, CGC_CY262
Notes: bvIs1 contains [ges-1p::age-1(cDNA)::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs1 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GTC ATT TTG GCA CCA TAG GAG-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
Proper citation: RRID:WB-STRAIN:WBStrain00005334 Copy
http://www.wormbase.org/db/get?name=WBStrain00005472
Source Database: WormBase (WB)
Affected Genes: WBGene00006793(unc-59)|WBGene00006829(unc-101)
Genomic Alteration: WBGene00006793(unc-59), WBGene00006829(unc-101)
Availability: available
Source References: EMPTY
Synonyms: unc-101(m1) unc-59(e261) I.
Alternate IDs: WB-STRAIN:DA501, CGC_DA501
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005472 Copy
http://www.wormbase.org/db/get?name=WBStrain00005473
Source Database: WormBase (WB)
Affected Genes: WBGene00006807(unc-75)|WBGene00006829(unc-101)
Genomic Alteration: WBGene00006807(unc-75), WBGene00006829(unc-101)
Availability: available
Source References: EMPTY
Synonyms: unc-75(e950) unc-101(m1) I.
Alternate IDs: WB-STRAIN:DA502, CGC_DA502
Notes: Unc. Eat.
Proper citation: RRID:WB-STRAIN:WBStrain00005473 Copy
http://www.wormbase.org/db/get?name=WBStrain00005470
Source Database: WormBase (WB)
Affected Genes: WBGene00006767(unc-31)
Genomic Alteration: WBGene00006767(unc-31)
Availability: available
Source References: PMID:7187364
Synonyms: sDf10 unc-31(e169)/nT1 IV; +/nT1 V.
Alternate IDs: WB-STRAIN:DA496, CGC_DA496
Notes: Heterozygotes are WT and segregate WT, Vul, Unc lethals (early larval) and dead eggs. Maintain by picking WT.|"Mutagen: Formaldehyde"
Proper citation: RRID:WB-STRAIN:WBStrain00005470 Copy
http://www.wormbase.org/db/get?name=WBStrain00005471
Source Database: WormBase (WB)
Affected Genes: WBGene00002334(let-59)|WBGene00006759(unc-22)
Genomic Alteration: WBGene00002334(let-59), WBGene00006759(unc-22)
Availability: available
Source References: PMID:3396868
Synonyms: let-59(s49) unc-22(s7)/nT1 IV; +/nT1 V.
Alternate IDs: WB-STRAIN:DA497, CGC_DA497
Notes: Heterozygotes are WT and segregate WT, Vul and lethal twitchers. Lethal early larval. Pick twitchers in 1% nicotine.
Proper citation: RRID:WB-STRAIN:WBStrain00005471 Copy
http://www.wormbase.org/db/get?name=WBStrain00005469
Source Database: WormBase (WB)
Affected Genes: WBGene00004019(phm-3)
Genomic Alteration: WBGene00004019(phm-3)
Availability: available
Source References: PMID:8462849, PMID:31735173
Synonyms: phm-3(ad493) III.
Alternate IDs: WB-STRAIN:DA493, CGC_DA493
Notes: Weak pharyngeal birefringence.
Proper citation: RRID:WB-STRAIN:WBStrain00005469 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
