Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
CZ3715 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005388 | Caenorhabditis elegans | gcy-33(ok232) V. | 1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele.|"Mutagen:UV/TMP" | WBGene00001553(gcy-33) | WBGene00001553(gcy-33) | WB-STRAIN:WBStrain00005388 | WormBase (WB) | WB | available | WB-STRAIN:CZ3715, CGC_CZ3715 | 2026-08-01 10:11:40 | 0 | |||
|
CZ3761 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005389 | Caenorhabditis elegans | ptp-3(mu256) II. | Low penetrance tail Vab and embryonic lethality.|"WBStrain mapped, WBPaper00060580 added based on AFP_Strain data." | WBGene00004215(ptp-3) | WBGene00004215(ptp-3) | WB-STRAIN:WBStrain00005389 | WormBase (WB) | WB | available | PMID:33147118 | WB-STRAIN:CZ3761, CGC_CZ3761 | 2026-08-01 10:11:40 | 0 | ||
|
CX12708 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005321 | Caenorhabditis elegans | ggr-2(lf62) X. | Made_by: Steven Flavell|"Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35." | WB-STRAIN:WBStrain00005321 | WormBase (WB) | WB | available | WB-STRAIN:CX12708, CGC_CX12708 | 2026-08-01 10:11:39 | 0 | |||||
|
CX11400 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005316 | Caenorhabditis elegans | kyIR9 (X: ~4745910 - ~4927296, N2>CB4856) X. | kyIR9 [X: ~4745910 - ~4927296, N2>CB4856] X. LG X contains N2 from ~4745910 - ~4927296; the rest is from CB4856. QX9 was crossed to CB4856; a recombinant F2 with N2 npr-1 and CB4856 tyra-3 was isolated. Its progeny was back-crossed to CB4856 8 times, picking npr-1 hets each round prior to homozygosing. | WB-STRAIN:WBStrain00005316 | WormBase (WB) | WB | available | PMID:31422888 | WB-STRAIN:CX11400, CGC_CX11400 | 2026-08-01 10:11:39 | 0 | ||||
|
CX11315 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005311 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Made_by: A. Sivasundar|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90." | WB-STRAIN:WBStrain00005311 | WormBase (WB) | WB | available | PMID:33820969 PMID:38564369 |
WB-STRAIN:CX11315, CGC_CX11315 | 2026-08-01 10:11:39 | 0 | ||||
|
CX14394 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005331 | Caenorhabditis elegans | npr-5(ok1583) V. | Derived by outcrossing RB1393 five times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.|"Made_by: Steven Flavell" | WBGene00021983(npr-5) | WBGene00021983(npr-5) | WB-STRAIN:WBStrain00005331 | WormBase (WB) | WB | available | PMID:38446031 PMID:38573858 |
WB-STRAIN:CX14394, CGC_CX14394 | 2026-08-01 10:11:39 | 2 | ||
|
CX14295 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005330 | Caenorhabditis elegans | pdfr-1(ok3425) III. | Decreased locomotion on food. Derived by outcrossing VC2609 five times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.|"Made_by: Steven Flavell"|"WBStrain mapped, WBPaper00059778 added based on AFP_Strain data." | WBGene00015735(pdfr-1) | WBGene00015735(pdfr-1) | WB-STRAIN:WBStrain00005330 | WormBase (WB) | WB | available | PMID:32510332 PMID:38573858 |
WB-STRAIN:CX14295, CGC_CX14295 | 2026-08-01 10:11:39 | 1 | ||
|
CX13079 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005327 | Caenorhabditis elegans | octr-1(ok371) X. | Derived by outcrossing VC224 four times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.|"Made_by: Steven Flavell"|"WBStrain provided so WBPaper00060134 paper added based on AFP_Strain data." | WBGene00006411(octr-1) | WBGene00006411(octr-1) | WB-STRAIN:WBStrain00005327 | WormBase (WB) | WB | available | PMID:32847964 | WB-STRAIN:CX13079, CGC_CX13079 | 2026-08-01 10:11:39 | 1 | ||
|
CX12726 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005325 | Caenorhabditis elegans | inx-9(ok1502) IV. | Increased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.|"Made_by: Steven Flavell" | WBGene00002131(inx-9) | WBGene00002131(inx-9) | WB-STRAIN:WBStrain00005325 | WormBase (WB) | WB | available | PMID:38573858 | WB-STRAIN:CX12726, CGC_CX12726 | 2026-08-01 10:11:39 | 0 | ||
|
CY577 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005341 | Caenorhabditis elegans | bvIs6. | bvIs6 [cat-4p::GFP + gcy-7p::GFP]. GFP localized to intestine, neurons and hypodermis in adults. GFP localized to neurons and seam cells in dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369.|"Made_by: C Wolkow & W Iser" | WB-STRAIN:WBStrain00005341 | WormBase (WB) | WB | available | WB-STRAIN:CY577, CGC_CY577 | 2026-08-01 10:11:40 | 0 | |||||
|
CY401 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005339 | Caenorhabditis elegans | sqt-1(sc13) age-1(mg109)/mnC1 [dpy-10(e128) unc-52(e444)] II. | Heterozygotes are WT and segregate WT, DpyUncs and Sqt. age-1(mg109) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive). age-1(mg109) homozygous animals that are maternally rescued for dauer formation are long-lived.|"Made_by: Ruvkun Lab" | WBGene00000090(age-1)|WBGene00001072(dpy-10)|WBGene00005016(sqt-1)|WBGene00006787(unc-52) | WBGene00000090(age-1), WBGene00001072(dpy-10), WBGene00005016(sqt-1), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00005339 | WormBase (WB) | WB | available | WB-STRAIN:CY401, CGC_CY401 | 2026-08-01 10:11:39 | 0 | |||
|
CY399 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005337 | Caenorhabditis elegans | sqt-1(sc13) age-1(mg109) II; pdk-1(mg261) X. | Sqt phenotype. The pdk-1(mg261) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg261 is an activating missense mutation Ala447Val. | WBGene00000090(age-1)|WBGene00003965(pdk-1)|WBGene00005016(sqt-1) | WBGene00000090(age-1), WBGene00003965(pdk-1), WBGene00005016(sqt-1) | WB-STRAIN:WBStrain00005337 | WormBase (WB) | WB | available | WB-STRAIN:CY399, CGC_CY399 | 2026-08-01 10:11:39 | 0 | |||
|
CY400 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005338 | Caenorhabditis elegans | sqt-1(sc13) age-1(mg109) II; akt-1(mg247) V. | Sqt phenotype. The akt-1(mg247) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg247 is an activating missense mutation Ala149Thr. | WBGene00000090(age-1)|WBGene00000102(akt-1)|WBGene00005016(sqt-1) | WBGene00000090(age-1), WBGene00000102(akt-1), WBGene00005016(sqt-1) | WB-STRAIN:WBStrain00005338 | WormBase (WB) | WB | available | WB-STRAIN:CY400, CGC_CY400 | 2026-08-01 10:11:39 | 0 | |||
|
CY251 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005333 | Caenorhabditis elegans | sqt-1(sc13) age-1(mg44) II; bvIs2. | bvIs2 contains [ric-19p::age-1(cDNA)::myc::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs2 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GCA CAG TTT TAC GAA AGG AAC-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47. | WBGene00000090(age-1)|WBGene00005016(sqt-1) | WBGene00000090(age-1), WBGene00005016(sqt-1) | WB-STRAIN:WBStrain00005333 | WormBase (WB) | WB | available | WB-STRAIN:CY251, CGC_CY251 | 2026-08-01 10:11:39 | 0 | |||
|
CY262 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005334 | Caenorhabditis elegans | sqt-1(sc13) age-1(mg44) II; bvIs1. | bvIs1 contains [ges-1p::age-1(cDNA)::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs1 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GTC ATT TTG GCA CCA TAG GAG-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47. | WBGene00000090(age-1)|WBGene00005016(sqt-1) | WBGene00000090(age-1), WBGene00005016(sqt-1) | WB-STRAIN:WBStrain00005334 | WormBase (WB) | WB | available | WB-STRAIN:CY262, CGC_CY262 | 2026-08-01 10:11:39 | 0 | |||
|
DA501 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005472 | Caenorhabditis elegans | unc-101(m1) unc-59(e261) I. | EMPTY | WBGene00006793(unc-59)|WBGene00006829(unc-101) | WBGene00006793(unc-59), WBGene00006829(unc-101) | WB-STRAIN:WBStrain00005472 | WormBase (WB) | WB | available | WB-STRAIN:DA501, CGC_DA501 | 2026-08-01 10:11:42 | 0 | |||
|
DA502 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005473 | Caenorhabditis elegans | unc-75(e950) unc-101(m1) I. | Unc. Eat. | WBGene00006807(unc-75)|WBGene00006829(unc-101) | WBGene00006807(unc-75), WBGene00006829(unc-101) | WB-STRAIN:WBStrain00005473 | WormBase (WB) | WB | available | WB-STRAIN:DA502, CGC_DA502 | 2026-08-01 10:11:42 | 0 | |||
|
DA496 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005470 | Caenorhabditis elegans | sDf10 unc-31(e169)/nT1 IV; +/nT1 V. | Heterozygotes are WT and segregate WT, Vul, Unc lethals (early larval) and dead eggs. Maintain by picking WT.|"Mutagen: Formaldehyde" | WBGene00006767(unc-31) | WBGene00006767(unc-31) | WB-STRAIN:WBStrain00005470 | WormBase (WB) | WB | available | PMID:7187364 | WB-STRAIN:DA496, CGC_DA496 | 2026-08-01 10:11:42 | 0 | ||
|
DA497 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005471 | Caenorhabditis elegans | let-59(s49) unc-22(s7)/nT1 IV; +/nT1 V. | Heterozygotes are WT and segregate WT, Vul and lethal twitchers. Lethal early larval. Pick twitchers in 1% nicotine. | WBGene00002334(let-59)|WBGene00006759(unc-22) | WBGene00002334(let-59), WBGene00006759(unc-22) | WB-STRAIN:WBStrain00005471 | WormBase (WB) | WB | available | PMID:3396868 | WB-STRAIN:DA497, CGC_DA497 | 2026-08-01 10:11:42 | 0 | ||
|
DA493 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005469 | Caenorhabditis elegans | phm-3(ad493) III. | Weak pharyngeal birefringence. | WBGene00004019(phm-3) | WBGene00004019(phm-3) | WB-STRAIN:WBStrain00005469 | WormBase (WB) | WB | available | PMID:8462849 PMID:31735173 |
WB-STRAIN:DA493, CGC_DA493 | 2026-08-01 10:11:42 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
