Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
DA472 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005467 | Caenorhabditis elegans | pha-2(ad472) X. | Misshapen pharynx; worms hatch with pharynx of correct gross shape, but disorganized, with nuclei misplaced. Most homozygotes arrest in L1, escapers grow up to become very starved adults with deformed pharynges with abnormally small terminal bulb, thick nucleated isthmus. Weakly cold sensitive. Makes dauers that don't recover; doesn't survive freezing well. | WBGene00004011(pha-2) | WBGene00004011(pha-2) | WB-STRAIN:WBStrain00005467 | WormBase (WB) | WB | available | PMID:8462849 | WB-STRAIN:DA472, CGC_DA472 | 2026-08-01 10:11:41 | 0 | ||
|
DA675 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005500 | Caenorhabditis elegans | unc-45(r450) dpy-1(e1) phm-3(ad493) III. | Dpy. Unc (ts). Phm. Weak pharyngeal birefringence. | WBGene00001063(dpy-1)|WBGene00004019(phm-3)|WBGene00006781(unc-45) | WBGene00001063(dpy-1), WBGene00004019(phm-3), WBGene00006781(unc-45) | WB-STRAIN:WBStrain00005500 | WormBase (WB) | WB | available | WB-STRAIN:DA675, CGC_DA675 | 2026-08-01 10:11:42 | 0 | |||
|
DA491 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005468 | Caenorhabditis elegans | dpy-20(e1282) unc-30(e191) IV. | Unc. Temperature sensitive Dpy. | WBGene00001079(dpy-20)|WBGene00006766(unc-30) | WBGene00001079(dpy-20), WBGene00006766(unc-30) | WB-STRAIN:WBStrain00005468 | WormBase (WB) | WB | available | WB-STRAIN:DA491, CGC_DA491 | 2026-08-01 10:11:42 | 0 | |||
|
DA678 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005501 | Caenorhabditis elegans | unc-57(ad592) dpy-5(e61) I. | DpyUnc. ad592 is Eat. Dpy is semi-dominant. | WBGene00001067(dpy-5)|WBGene00006791(unc-57) | WBGene00001067(dpy-5), WBGene00006791(unc-57) | WB-STRAIN:WBStrain00005501 | WormBase (WB) | WB | available | PMID:8462849 | WB-STRAIN:DA678, CGC_DA678 | 2026-08-01 10:11:42 | 0 | ||
|
DA596 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005486 | Caenorhabditis elegans | snt-1(ad596) II. | Eat mutant. Strong Unc Eat. Jerky backward Unc. Hypomorph. | WBGene00004921(snt-1) | WBGene00004921(snt-1) | WB-STRAIN:WBStrain00005486 | WormBase (WB) | WB | available | PMID:8462849 | WB-STRAIN:DA596, CGC_DA596 | 2026-08-01 10:11:42 | 0 | ||
|
DA573 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005483 | Caenorhabditis elegans | eat-14(ad573) X. | EMPTY | WBGene00001143(eat-14) | WBGene00001143(eat-14) | WB-STRAIN:WBStrain00005483 | WormBase (WB) | WB | available | PMID:8462849 | WB-STRAIN:DA573, CGC_DA573 | 2026-08-01 10:11:42 | 0 | ||
|
DA589 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005484 | Caenorhabditis elegans | unc-32(e189) emb-9(hc70) III. | Unc. Temperature sensitive. Maintain at 15C. hc70 is semi-dominant. | WBGene00001263(emb-9)|WBGene00006768(unc-32) | WBGene00001263(emb-9), WBGene00006768(unc-32) | WB-STRAIN:WBStrain00005484 | WormBase (WB) | WB | available | WB-STRAIN:DA589, CGC_DA589 | 2026-08-01 10:11:42 | 0 | |||
|
DA572 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005482 | Caenorhabditis elegans | eat-4(ad572) III. | Starved appearance. Reverts spontaneously-Do not passage! Clone starved-looking progeny with abnormal fast pharyngeal pumping to maintain. | WBGene00001135(eat-4) | WBGene00001135(eat-4) | WB-STRAIN:WBStrain00005482 | WormBase (WB) | WB | available | PMID:8462849 PMID:31306683 |
WB-STRAIN:DA572, CGC_DA572 | 2026-08-01 10:11:42 | 1 | ||
|
DA538 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005479 | Caenorhabditis elegans | adDf538 I. | Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. PKA phm-2(ad538). | WB-STRAIN:WBStrain00005479 | WormBase (WB) | WB | available | PMID:8462849 | WB-STRAIN:DA538, CGC_DA538 | 2026-08-01 10:11:42 | 0 | ||||
|
DA631 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005496 | Caenorhabditis elegans | eat-3(ad426) II; him-8(e1489) IV. | Abnormal feeding. Slow, irregular feeding. eat-3 exhibits strong maternal effect; dauers seldom recover; Him.|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data." | WBGene00001134(eat-3)|WBGene00001867(him-8) | WBGene00001134(eat-3), WBGene00001867(him-8) | WB-STRAIN:WBStrain00005496 | WormBase (WB) | WB | available | PMID:8462849 | WB-STRAIN:DA631, CGC_DA631 | 2026-08-01 10:11:42 | 2 | ||
|
DA612 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005494 | Caenorhabditis elegans | bli-4(e937) adDf538 I. | Blistered. Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. adDf538 previously called phm-2(ad538). | WBGene00000254(bli-4) | WBGene00000254(bli-4) | WB-STRAIN:WBStrain00005494 | WormBase (WB) | WB | available | WB-STRAIN:DA612, CGC_DA612 | 2026-08-01 10:11:42 | 0 | |||
|
DA620 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005495 | Caenorhabditis elegans | eat-2(ad465) lin-7(e1413) unc-52(e444) II. | Abnormal feeding: slow, regular pumping. Vulvaless (incomplete penetrance). Unc. | WBGene00001133(eat-2)|WBGene00002996(lin-7)|WBGene00006787(unc-52) | WBGene00001133(eat-2), WBGene00002996(lin-7), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00005495 | WormBase (WB) | WB | available | WB-STRAIN:DA620, CGC_DA620 | 2026-08-01 10:11:42 | 0 | |||
|
DA609 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005493 | Caenorhabditis elegans | npr-1(ad609) X. | Causes worms to aggregate (Bor). Social.|"Supplementary_genotype npr-1(ad609)"|"WBStrain mapped, WBPaper00061439 added based on AFP_Strain data."|"WBStrain provided so WBPaper00061436 paper added based on AFP_Strain data." | WBGene00003807(npr-1) | WBGene00003807(npr-1) | WB-STRAIN:WBStrain00005493 | WormBase (WB) | WB | available | PMID:18993077 PMID:34038721 PMID:37572357 PMID:38446031 |
WB-STRAIN:DA609, CGC_DA609 | 2026-08-01 10:11:42 | 5 | ||
|
CZ5261 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005409 | Caenorhabditis elegans | juIs198 V. | juIs198 [unc-25p::YFP::rab-5 + ttx-3p::RFP] V. YFP-labeled RAB-5 synaptic vesicles in GABAergic motor neurons. Reference: Sann SB, Crane MM, Lu H, Jin Y. PLoS One. 2012;7(6):e37930.|"Mutagen:UV/TMP" | WB-STRAIN:WBStrain00005409 | WormBase (WB) | WB | available | PMID:37432924 | WB-STRAIN:CZ5261, CGC_CZ5261 | 2026-08-01 10:11:41 | 0 | ||||
|
DA601 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005489 | Caenorhabditis elegans | eat-6(ad601) V. | Eat. Long pumps; slippery isthmus and corpus. | WBGene00001137(eat-6) | WBGene00001137(eat-6) | WB-STRAIN:WBStrain00005489 | WormBase (WB) | WB | available | WB-STRAIN:DA601, CGC_DA601 | 2026-08-01 10:11:42 | 0 | |||
|
DA599 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005488 | Caenorhabditis elegans | eat-8(ad599) III. | Abnormal feeding. Brief, rare pumps. Slight coiler Unc. | WBGene00001139(eat-8) | WBGene00001139(eat-8) | WB-STRAIN:WBStrain00005488 | WormBase (WB) | WB | available | PMID:8462849 | WB-STRAIN:DA599, CGC_DA599 | 2026-08-01 10:11:42 | 0 | ||
|
CZ9676 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005418 | Caenorhabditis elegans | acr-2(n2595 n2420) X. | Intragenic suppression of n2420 gain of function; n2595 is a nonsense mutation of acr-2. G to A at residue 525, causing W175-STOP. (WT: CACGGAGATGTGACATGGGTCCCACCTGCAATGTT) (n2595: CACGGAGATGTGACATGAGTCCCACCTGCAATGTT). Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.|"Made_by: Tammy Stawicki" | WBGene00000042(acr-2) | WBGene00000042(acr-2) | WB-STRAIN:WBStrain00005418 | WormBase (WB) | WB | available | WB-STRAIN:CZ9676, CGC_CZ9676 | 2026-08-01 10:11:41 | 1 | |||
|
CZ7112 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005414 | Caenorhabditis elegans | lin-31(n301) vab-1(e2027) II. | Muv. | WBGene00003017(lin-31)|WBGene00006868(vab-1) | WBGene00003017(lin-31), WBGene00006868(vab-1) | WB-STRAIN:WBStrain00005414 | WormBase (WB) | WB | available | WB-STRAIN:CZ7112, CGC_CZ7112 | 2026-08-01 10:11:41 | 0 | |||
|
CZ8332 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005415 | Caenorhabditis elegans | juIs223 IV. | juIs223 [ttr-39p::mCherry + ttx-3p::GFP] IV. Transcriptional reporter with ttr-39 promoter driving mCherry expression in DD and VD neurons. Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265. | WB-STRAIN:WBStrain00005415 | WormBase (WB) | WB | available | WB-STRAIN:CZ8332, CGC_CZ8332 | 2026-08-01 10:11:41 | 0 | |||||
|
DA658 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005498 | Caenorhabditis elegans | lon-2(e678) npr-1(n1353) X. | Long. Clumps. npr-1 pka bor-1.|"Made_by: Davis/Faulkner" | WBGene00003056(lon-2)|WBGene00003807(npr-1) | WBGene00003056(lon-2), WBGene00003807(npr-1) | WB-STRAIN:WBStrain00005498 | WormBase (WB) | WB | available | PMID:9741632 | WB-STRAIN:DA658, CGC_DA658 | 2026-08-01 10:11:42 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
