Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00005421
Source Database: WormBase (WB)
Availability: available
Source References: PMID:31983639, PMID:38134228, PMID:38783998, PMID:39378880, PMID:39746999
Synonyms: zdIs5 I.
Alternate IDs: WB-STRAIN:CZ10175, CGC_CZ10175
Notes: WBStrain provided so WBPaper00060426 paper added based on AFP_Strain data.|"zdIs5 [mec-4p::GFP + lin-15(+)] I. SK4005 was outcrossed 10x to produce this strain."
Proper citation: RRID:WB-STRAIN:WBStrain00005421 Copy
http://www.wormbase.org/db/get?name=WBStrain00005441
Source Database: WormBase (WB)
Affected Genes: WBGene00004443(rpl-29)
Genomic Alteration: WBGene00004443(rpl-29)
Availability: available
Source References: EMPTY
Synonyms: juSi123 II; rpl-29(tm3555) IV.
Alternate IDs: WB-STRAIN:CZ18550, CGC_CZ18550
Notes: juSi123 [rpl-29::GFP] II. Strong GFP signal allowing visualization of ribosomes. GFP inserted at C-terminus of RPL-29. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.|"Made_by: Ken Noma"
Proper citation: RRID:WB-STRAIN:WBStrain00005441 Copy
http://www.wormbase.org/db/get?name=WBStrain00005442
Source Database: WormBase (WB)
Affected Genes: WBGene00004487(rps-18)
Genomic Alteration: WBGene00004487(rps-18)
Availability: available
Source References: EMPTY
Synonyms: juSi83 II; rps-18(ok3353) IV/nT1[qIs51] (IV;V).
Alternate IDs: WB-STRAIN:CZ18637, CGC_CZ18637
Notes: juSi83 [GFP::rps-18 + Cbr-unc-119(+)] II. Homozygous lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT GFP+ and segregate WT GFP+, Vul and dead eggs. Non-conditonal GFP-tagged ribosomes; array over-expressing N-terminally tagged rps-18 (small ribosomal subunit) partially rescues rps-18(ok3353) larval arrest (some animals will escape L1 arrest and develop to L3 stage). Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.|"Made_by: Ken Noma"
Proper citation: RRID:WB-STRAIN:WBStrain00005442 Copy
http://www.wormbase.org/db/get?name=WBStrain00005436
Source Database: WormBase (WB)
Availability: available
Source References: PMID:31995031
Synonyms: juIs319.
Alternate IDs: WB-STRAIN:CZ13896, CGC_CZ13896
Notes: juIs319 [col-19p::GCaMP3 + col-19p::tdTomato]. col-19p::GCaMP3 expression is induced by either laser or needle wounding. col-19 is an adult-specific collagen and is not expressed until the end of the L4 larval stage. Reference: Xu S & Chisholm AD. Curr Biol. 2011 Dec 6;21(23):1960-7.
Proper citation: RRID:WB-STRAIN:WBStrain00005436 Copy
http://www.wormbase.org/db/get?name=WBStrain00005437
Source Database: WormBase (WB)
Availability: available
Source References: PMID:31995031
Synonyms: juIs352.
Alternate IDs: WB-STRAIN:CZ14748, CGC_CZ14748
Notes: juIs352 [col-19p::GFP::moesin]. GFP::moesin expression labels F-actin by fusing GFP to sequences that encoded the C-terminal end of the sole Drosophila MER homolog, moesin. The F-actin ring (GFP::moesin) is induced upon needle wounding. Reference: Xu S & Chisholm AD. Curr Biol. 2011 Dec 6;21(23):1960-7.
Proper citation: RRID:WB-STRAIN:WBStrain00005437 Copy
http://www.wormbase.org/db/get?name=WBStrain00005435
Source Database: WormBase (WB)
Availability: available
Source References: PMID:34534446, PMID:37980357, PMID:38797871
Synonyms: juIs76 [unc-25p::GFP + lin-15(+)] II
Alternate IDs: WB-STRAIN:CZ13799, CGC_CZ13799
Notes: juIs76 [unc-25p::GFP + lin-15(+)] II. GFP expression in GABAergic motor neurons. [NOTE: (10/11/2018) CZ13799 was sent as a replacement for CZ1200, which was found to carry background mutations affecting neuron morphology.] Derived by outcrossing CZ1200 to remove lin-15(n765) and unidentified background mutations. Reference (for original juIs76 strain): Huang X, et al. Neuron. 2002 May 16;34(4):563-76.|"Supplementary_genotype juIs76"
Proper citation: RRID:WB-STRAIN:WBStrain00005435 Copy
http://www.wormbase.org/db/get?name=WBStrain00005451
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: juEx6916.
Alternate IDs: WB-STRAIN:CZ22703, CGC_CZ22703
Notes: juEx6916 [myo-3p::PH::miniSOG(Q103L) + myo-3p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in body wall muscles. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
Proper citation: RRID:WB-STRAIN:WBStrain00005451 Copy
http://www.wormbase.org/db/get?name=WBStrain00005444
Source Database: WormBase (WB)
Affected Genes: WBGene00004487(rps-18)
Genomic Alteration: WBGene00004487(rps-18)
Availability: available
Source References: EMPTY
Synonyms: juSi94 II; rps-18(ok3353) juIs409 IV.
Alternate IDs: WB-STRAIN:CZ19297, CGC_CZ19297
Notes: juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs409 [rgef-1p::GFP1-10 + ttx-3p::RFP] IV. Pan-neuronal-specific expression of split GFP reporter allows visualization of ribosomes in neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.|"Made_by: Ken Noma"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00005444 Copy
http://www.wormbase.org/db/get?name=WBStrain00005464
Source Database: WormBase (WB)
Affected Genes: WBGene00001137(eat-6)
Genomic Alteration: WBGene00001137(eat-6)
Availability: available
Source References: PMID:8462849, PMID:27936181, PMID:31735173, PMID:32292107
Synonyms: eat-6(ad467) V.
Alternate IDs: WB-STRAIN:DA467, CGC_DA467
Notes: Abnormal feeding. Strong relaxation defective. NOTE: This strain is reportedly homozygous for an unknown X-linked unc mutation (10/31/2017).|"WBStrain provided so WBPaper00059550 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005464 Copy
http://www.wormbase.org/db/get?name=WBStrain00005461
Source Database: WormBase (WB)
Affected Genes: WBGene00001133(eat-2)
Genomic Alteration: WBGene00001133(eat-2)
Availability: available
Source References: EMPTY
Synonyms: eat-2(ad453) II.
Alternate IDs: WB-STRAIN:DA453, CGC_DA453
Notes: Eat. Scrawny. Slow pumping.
Proper citation: RRID:WB-STRAIN:WBStrain00005461 Copy
http://www.wormbase.org/db/get?name=WBStrain00005460
Source Database: WormBase (WB)
Affected Genes: WBGene00001079(dpy-20)|WBGene00044731(eat-1)
Genomic Alteration: WBGene00001079(dpy-20), WBGene00044731(eat-1)
Availability: available
Source References: PMID:8462849
Synonyms: eat-1(e2343) dpy-20(e1282) IV.
Alternate IDs: WB-STRAIN:DA449, CGC_DA449
Notes: Thin, starved, healthy adults. Retain few eggs. Slow irregular pumping at 16, 20, 25C. Dpy.
Proper citation: RRID:WB-STRAIN:WBStrain00005460 Copy
http://www.wormbase.org/db/get?name=WBStrain00005458
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00000898(daf-2)|WBGene00001073(dpy-11)|WBGene00003056(lon-2)|WBGene00004397(rol-6)|WBGene00006767(unc-31)|WBGene00006873(vab-7)
Genomic Alteration: WBGene00000254(bli-4), WBGene00000898(daf-2), WBGene00001073(dpy-11), WBGene00003056(lon-2), WBGene00004397(rol-6), WBGene00006767(unc-31), WBGene00006873(vab-7)
Availability: available
Source References: EMPTY
Synonyms: bli-4(e937) I; rol-6(e187) II; daf-2(e1368) vab-7(e1562) III; unc-31(e928) IV; dpy-11(e224) V; lon-2(e678) X.
Alternate IDs: WB-STRAIN:DA438, CGC_DA438
Notes: Linkage mapping strain. Maintain at 15C.
Proper citation: RRID:WB-STRAIN:WBStrain00005458 Copy
http://www.wormbase.org/db/get?name=WBStrain00005459
Source Database: WormBase (WB)
Affected Genes: WBGene00004395(rol-3)|WBGene00006778(unc-42)
Genomic Alteration: WBGene00004395(rol-3), WBGene00006778(unc-42)
Availability: available
Source References: EMPTY
Synonyms: rol-3(e754) unc-42(e270) V.
Alternate IDs: WB-STRAIN:DA443, CGC_DA443
Notes: Roller Unc. e754 is cold-sensitive: lethal at 15C.
Proper citation: RRID:WB-STRAIN:WBStrain00005459 Copy
http://www.wormbase.org/db/get?name=WBStrain00005456
Source Database: WormBase (WB)
Affected Genes: WBGene00006780(unc-44)
Genomic Alteration: WBGene00006780(unc-44)
Availability: available
Source References: PMID:37751746
Synonyms: unc-44(ju1412[unc-44::GFP]) IV.
Alternate IDs: WB-STRAIN:CZ24990, CGC_CZ24990
Notes: Endogenous unc-44 locus tagged for UNC-44L::GFP expression. The long isoform of UNC-44 is specific to neuronal expression. Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.|"Supplementary_genotype unc-44(ju1412[unc-44::GFP]) (IV)"
Proper citation: RRID:WB-STRAIN:WBStrain00005456 Copy
http://www.wormbase.org/db/get?name=WBStrain00005454
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: juEx7105.
Alternate IDs: WB-STRAIN:CZ23281, CGC_CZ23281
Notes: juEx7105 [mec-4p::PH::miniSOG(Q103L) + mec-4p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in mechanosensory neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
Proper citation: RRID:WB-STRAIN:WBStrain00005454 Copy
http://www.wormbase.org/db/get?name=WBStrain00005596
Source Database: WormBase (WB)
Affected Genes: WBGene00007630(har-1)
Genomic Alteration: WBGene00007630(har-1)
Availability: available
Source References: EMPTY
Synonyms: har-1(ad2155) III.
Alternate IDs: WB-STRAIN:DA2155, CGC_DA2155
Notes: Hemiasterlin resistant. Maintain under normal conditions. Reference: Zubovych IO, et al. Mol Biol Cell. 2010 Mar 15;21(6):956-69.
Proper citation: RRID:WB-STRAIN:WBStrain00005596 Copy
http://www.wormbase.org/db/get?name=WBStrain00005593
Source Database: WormBase (WB)
Affected Genes: WBGene00001173(egl-4)
Genomic Alteration: WBGene00001173(egl-4)
Availability: available
Source References: EMPTY
Synonyms: egl-4(ks62) IV; adEx2143.
Alternate IDs: WB-STRAIN:DA2143, CGC_DA2143
Notes: adEx2143 [tax-4p::pkg-1 + rol-6p::GFP]. Maintain by picking GFP+. pkg-1 is the new name of egl-4. Reference: You et al (2008) Cell Metab 7(3):249-57.
Proper citation: RRID:WB-STRAIN:WBStrain00005593 Copy
http://www.wormbase.org/db/get?name=WBStrain00005590
Source Database: WormBase (WB)
Affected Genes: WBGene00004780(ser-7)
Genomic Alteration: WBGene00004780(ser-7)
Availability: available
Source References: PMID:33007049, PMID:38514005, PMID:39025433
Synonyms: ser-7(tm1325) X
Alternate IDs: WB-STRAIN:DA2100, CGC_DA2100
Notes: Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00060976 added based on AFP_Strain data."|"WBStrain provided so WBPaper00060405 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005590 Copy
http://www.wormbase.org/db/get?name=WBStrain00005509
Source Database: WormBase (WB)
Affected Genes: WBGene00001142(eat-13)|WBGene00006750(unc-10)
Genomic Alteration: WBGene00001142(eat-13), WBGene00006750(unc-10)
Availability: available
Source References: PMID:8462849
Synonyms: unc-10(e102) eat-13(ad522) X.
Alternate IDs: WB-STRAIN:DA726, CGC_DA726
Notes: Unc. Eat mutant. Slippery pharynx-Slight relaxation defect.
Proper citation: RRID:WB-STRAIN:WBStrain00005509 Copy
http://www.wormbase.org/db/get?name=WBStrain00005506
Source Database: WormBase (WB)
Affected Genes: WBGene00020770(eat-17)
Genomic Alteration: WBGene00020770(eat-17)
Availability: available
Source References: PMID:8462849
Synonyms: eat-17(ad707) X.
Alternate IDs: WB-STRAIN:DA707, CGC_DA707
Notes: Eat mutant. Stuffs corpus and isthmus. Abnormality in m6 and m7 contraction timing. Displays clumping behavior; isolated in an RC301 background, so it's likely to have the RC301 bor-1 mutation.
Proper citation: RRID:WB-STRAIN:WBStrain00005506 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
