Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00050814
Source Database: WormBase (WB)
Affected Genes: WBGene00000908(daf-12)
Genomic Alteration: WBGene00000908(daf-12)
Availability: unknown
Synonyms: daf-12(ot870[daf-12::GFP::3xFlag]) X.
Notes: Superficially wildtype. GFP tag inserted into endogenous daf-12 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted
Proper citation: RRID:WB-STRAIN:WBStrain00050814 Copy
http://www.wormbase.org/db/get?name=WBStrain00050816
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00000912(daf-16)
Genomic Alteration: WBGene00000898(daf-2), WBGene00000912(daf-16)
Availability: unknown
Synonyms: daf-16(ot853[daf-16::mNG::3xFlag::AID]) I; ieSi57 II; daf-2(e1370) III.
Notes: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted
Proper citation: RRID:WB-STRAIN:WBStrain00050816 Copy
http://www.wormbase.org/db/get?name=WBStrain00050763
Source Database: WormBase (WB)
Affected Genes: WBGene00006547(tbx-11)
Genomic Alteration: WBGene00006547(tbx-11)
Availability: unknown
Synonyms: tbx-11(luc144) III.
Notes: Made_by: Josef Rhsner|"Wild-type morphology. CRISPR/Cas9 engineered 1.3 kb deletion of the tbx-11 locus. Flanking sequence: aaaaataacaaaataacaaggaatgagaagggaaaacaggaaaaatacac / ttgccacgtgttgggcgggaaaacgcgtagtcatccggcaggtgtaacct Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421"
Proper citation: RRID:WB-STRAIN:WBStrain00050763 Copy
http://www.wormbase.org/db/get?name=WBStrain00050761
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00009163(drsh-1)|WBGene00011908(pash-1)
Genomic Alteration: WBGene00006843(unc-119), WBGene00009163(drsh-1), WBGene00011908(pash-1)
Availability: unknown
Synonyms: drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV; lucIs20; lucIs24.
Notes: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Endogenous pash-1 tagged with the AID peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.|"Made_by: Philipp Dexheimer"
Proper citation: RRID:WB-STRAIN:WBStrain00050761 Copy
http://www.wormbase.org/db/get?name=WBStrain00050767
Source Database: WormBase (WB)
Availability: unknown
Synonyms: wdIs132; uIs152.
Notes: Made_by: Seth Taylor in the Miller Lab|"wdIs132 [gcy-35::GFP]. uIs152 [mec-3::RFP]. AVM neurons are labeled with GFP and RFP. Can be used to isolate AVM by FACS. wdIs132 arose from spontaneous integration of kyEx1162 [gcy-35::GFP]. Used by CeNGEN project for RNA-Seq (https:"
Proper citation: RRID:WB-STRAIN:WBStrain00050767 Copy
http://www.wormbase.org/db/get?name=WBStrain00050800
Source Database: WormBase (WB)
Availability: unknown
Synonyms: jsTi1492 II.
Notes: jsTi1492 [LoxP::mex-5p::FLP::SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] II. jsTi1492 is prone to silencing; pick animals with GFP+ germlines to maintain. jsTi1492 is an RMCE landing site inserted using miniMos located on Chr II at at 3,160,571 (WB273 genome; -8.14 m.u.) inserted in a repeat region between sri-34 and fbxc-55. Insertsion site ttttttgcaaaaaagtgcagtcataTAtgtatgtaaaaaattaattgaagac with rpl-28 transcription toward sri-34. Insertion site is ambiguous but likely near the edge of sri-34 side of the repeat region. Reference: Nonet ML. Genetics. 2020.
Proper citation: RRID:WB-STRAIN:WBStrain00050800 Copy
http://www.wormbase.org/db/get?name=WBStrain00050765
Source Database: WormBase (WB)
Affected Genes: WBGene00000483(che-1)
Genomic Alteration: WBGene00000483(che-1)
Availability: unknown
Synonyms: che-1(luc174) I.
Notes: Made_by: Julien Charest|"Wild-type morphology. CRISPR/Cas9 engineered 3.38 kB deletion of the che-1 locus. Flank: caaaaacatcacaaaaataa"
Proper citation: RRID:WB-STRAIN:WBStrain00050765 Copy
http://www.wormbase.org/db/get?name=WBStrain00050768
Source Database: WormBase (WB)
Availability: unknown
Synonyms: ynIs37 III; ufIs26.
Notes: Made_by: John Tipps in the Miller Lab|"ynIs37 [flp-13p::GFP] III. ufIs26 [unc-4p::mCherry + lin-15(+)]. I5 neurons are labeled with GFP and RFP. Can be used to isolate I5 by FACS. Used by CeNGEN project for RNA-Seq (https:"
Proper citation: RRID:WB-STRAIN:WBStrain00050768 Copy
http://www.wormbase.org/db/get?name=WBStrain00050801
Source Database: WormBase (WB)
Availability: unknown
Synonyms: jsTi1453 jsSi1527 I; jsTi1493 jsSi1549 IV.
Notes: jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1527 [LoxP::lexO 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1549 [LoxP::mec-4p::lexA-L-QF::FRT-3] IV. RMCE derived single copy lexO GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p lexA-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
Proper citation: RRID:WB-STRAIN:WBStrain00050801 Copy
http://www.wormbase.org/db/get?name=WBStrain00050751
Source Database: WormBase (WB)
Availability: unknown
Synonyms: lucEx755.
Notes: lucEx755 [tbx-32::GFP(fosmid) + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal TBX-32 direct fusion fosmid-based reporter. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421|"Made_by: Julien Charest"
Proper citation: RRID:WB-STRAIN:WBStrain00050751 Copy
http://www.wormbase.org/db/get?name=WBStrain00050754
Source Database: WormBase (WB)
Availability: unknown
Synonyms: lucEx825.
Notes: lucEx825 [tbx-34::T2A::GFP::H2B::tbx-34 3'UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal tbx-34 reporter includes 755 bp of tbx-34 upstream region and 4.4 kb of downstream region. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421|"Made_by: Julien Charest"
Proper citation: RRID:WB-STRAIN:WBStrain00050754 Copy
http://www.wormbase.org/db/get?name=WBStrain00050753
Source Database: WormBase (WB)
Availability: unknown
Synonyms: lucEx824.
Notes: lucEx824 [mab-9::T2A::GFP::H2B::mab-9 3'UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal mab-9 reporter includes 3.1 kb of mab-9 upstream region and 1.5 kb of downstream region. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421|"Made_by: Julien Charest"
Proper citation: RRID:WB-STRAIN:WBStrain00050753 Copy
http://www.wormbase.org/db/get?name=WBStrain00050740
Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00006556(tbx-37)|WBGene00006557(tbx-38)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00006556(tbx-37), WBGene00006557(tbx-38)
Availability: unknown
Synonyms: tbx-37(tm314) tbx-38(tm581)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III.
Notes: qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygote animals show roller phenotype and express GFP in the distal tip cells. Segregate roller and GFP(+) heterozygotes, embryonic lethal qC1 homozygotes and embryonic lethal tbx-37/38 homozygotes. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
Proper citation: RRID:WB-STRAIN:WBStrain00050740 Copy
http://www.wormbase.org/db/get?name=WBStrain00050744
Source Database: WormBase (WB)
Affected Genes: WBGene00003280(mir-52)
Genomic Alteration: WBGene00003280(mir-52)
Availability: unknown
Synonyms: nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X, lucIs24.
Notes: lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Pick GFP+ animals to maintain balanced line. Balanced mir-51 family mutant expressing a mirtron-version of mir-51. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP mir-51 family homozygous mutants. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Non-GFP mir-51 family homozygous mutants rescued by mirtron-51 transgene are viable, but slow-growing and sick. Strain is derived from injection into parental strain MT17143. lucIs24 is a spontaneous integrant originating from a complex extra-chromosomal array, the genomic location of the transgene is unknown. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.|"Made_by: Philipp Dexheimer"
Proper citation: RRID:WB-STRAIN:WBStrain00050744 Copy
http://www.wormbase.org/db/get?name=WBStrain00050748
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: lucSi100 II; unc-119(ed3) III.
Notes: lucSi100 [hsp16.41::vhhGFP4::zif-1::SL2::mCherry::his-11::tbb-2 3'UTR] II. Superficially wild-type morphology. Single-copy insertion of a GFP-nanobody::zif-1 fusion transgene under a heat-shock promoter for timely controlled degradation of GFP-tagged proteins (Wang et al. (2017). A toolkit for GFP-mediated tissue-specific protein degradation in C. elegans. Development 144, 2694-2701.)
Proper citation: RRID:WB-STRAIN:WBStrain00050748 Copy
http://www.wormbase.org/db/get?name=WBStrain00050747
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00011908(pash-1)
Genomic Alteration: WBGene00006843(unc-119), WBGene00011908(pash-1)
Availability: unknown
Synonyms: pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV.
Notes: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous pash-1 tagged with the auxin-inducible-degron (AID) peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.|"Made_by: Philipp Dexheimer"
Proper citation: RRID:WB-STRAIN:WBStrain00050747 Copy
http://www.wormbase.org/db/get?name=WBStrain00050738
Source Database: WormBase (WB)
Affected Genes: WBGene00000991(dhs-28)
Genomic Alteration: WBGene00000991(dhs-28)
Availability: unknown
Synonyms: dhs-28(ldr6) X; ldrIs1; ldrIs2.
Notes: ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr6 is G-to-A causing a G158E substitution. Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The G158E substitution site of the ldr6 mutant is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276|"ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr6 is G158A (Gly-Arg). Super-sized lipid droplets. Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276"
Proper citation: RRID:WB-STRAIN:WBStrain00050738 Copy
http://www.wormbase.org/db/get?name=WBStrain00050843
Source Database: WormBase (WB)
Affected Genes: WBGene00004010(pha-1)
Genomic Alteration: WBGene00004010(pha-1)
Availability: unknown
Synonyms: pha-1(e2123) III; otEx7225.
Notes: otEx7225 [eat-5(fosmid WRM0621dG04)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
Proper citation: RRID:WB-STRAIN:WBStrain00050843 Copy
http://www.wormbase.org/db/get?name=WBStrain00050842
Source Database: WormBase (WB)
Availability: unknown
Synonyms: otIs439; hdIs32.
Notes: Made_by: Oliver Hobert Lab|"otIs439 [lad-2p::GFP + pha-1(+)]. hdIs32 [glr-1::DsRed2]. SMD neurons are labeled with GFP and DsRed2. Can be used to isolate SMD by FACS. Used by CeNGEN project for RNA-Seq (https:"
Proper citation: RRID:WB-STRAIN:WBStrain00050842 Copy
http://www.wormbase.org/db/get?name=WBStrain00039381
Source Database: WormBase (WB)
Availability: unknown
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC40400
Notes: Made_by: Vancouver KO Group
Proper citation: RRID:WB-STRAIN:WBStrain00039381 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
