Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 463 showing 9241 ~ 9260 out of 147,236 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00006452

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006452

Source Database: WormBase (WB)
Affected Genes: WBGene00006604(tra-1)
Genomic Alteration: WBGene00006604(tra-1)
Availability: available
Source References: PMID:32857970
Synonyms: tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III.
Alternate IDs: WB-STRAIN:DZ840, CGC_DZ840
Notes: tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III.|"WBStrain mapped, WBPaper00060142 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00006452 Copy   

    • RRID:WB-STRAIN:WBStrain00006451

http://www.wormbase.org/db/get?name=WBStrain00006451

Source Database: WormBase (WB)
Affected Genes: WBGene00001438(fkh-6)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00001438(fkh-6), WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II.
Alternate IDs: WB-STRAIN:DZ710, CGC_DZ710
Notes: fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II.

Proper citation: RRID:WB-STRAIN:WBStrain00006451 Copy   

    • RRID:WB-STRAIN:WBStrain00006449

http://www.wormbase.org/db/get?name=WBStrain00006449

Source Database: WormBase (WB)
Affected Genes: WBGene00006605(tra-2)|WBGene00006962(xol-1)
Genomic Alteration: WBGene00006605(tra-2), WBGene00006962(xol-1)
Availability: available
Source References: EMPTY
Synonyms: tra-2(ar221) II; xol-1(y9) X; rdIs4.
Alternate IDs: WB-STRAIN:DZ683, CGC_DZ683
Notes: rdIs4 [ehn-3a::Venus(delta)]. Temperature-sensitive. Must be maintained at 15C to produce progeny. Strain develops as hermaphrodites at 15C (some animals are intersex with male tails), and develops as XX pseudomales at 25C. GFP expressed in gonadal precursors. Reference: Kroetz MB & Zarkower D. G3 (Bethesda). 2015 Oct 23;5(12):2831-41.

Proper citation: RRID:WB-STRAIN:WBStrain00006449 Copy   

    • RRID:WB-STRAIN:WBStrain00006448

http://www.wormbase.org/db/get?name=WBStrain00006448

Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)|WBGene00003100(mab-3)|WBGene00004334(ref-1)|WBGene00006744(unc-4)
Genomic Alteration: WBGene00001867(him-8), WBGene00003100(mab-3), WBGene00004334(ref-1), WBGene00006744(unc-4)
Availability: available
Source References: EMPTY
Synonyms: mab-3(e1240) unc-4(e120) ref-1(ez11) II; him-8(e1489) IV.
Alternate IDs: WB-STRAIN:DZ393, CGC_DZ393
Notes: Made_by: J. Ross Wolff|"Unc (cannot back). WT male tail."

Proper citation: RRID:WB-STRAIN:WBStrain00006448 Copy   

    • RRID:WB-STRAIN:WBStrain00006446

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006446

Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)
Genomic Alteration: WBGene00001867(him-8)
Availability: available
Source References: EMPTY
Synonyms: ezIs2 III; him-8(e1489) IV.
Alternate IDs: WB-STRAIN:DZ325, CGC_DZ325
Notes: ezIs2 [fkh-6::GFP + unc-119(+)]. ezIs2 was integrated with pPD95.69 (fkh-6 promoter and unc-54 3') and pMM106b (unc-119(+)). Worms are 100% non-Unc (the unc-119 background has been crossed out). GFP expression in adult hermaphrodite spermatheca is bright and weak staining is also observed in the proximal sheath cells. Weak GFP staining is also observed in Z1/Z4 cells in both sexes.|"Made_by: Weiru Chang"|"Mutagen:Gamma Rays"

Proper citation: RRID:WB-STRAIN:WBStrain00006446 Copy   

    • RRID:WB-STRAIN:WBStrain00006459

http://www.wormbase.org/db/get?name=WBStrain00006459

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: eeEx106.
Alternate IDs: WB-STRAIN:EC106, CGC_EC106
Notes: eeEx106 [hil-1::GFP + rol-6(su1006)]. GFP expression in body wall muscles, in the vulva sex muscles, in the marginal cells of the pharynx, in a limited number of head neurons, in the cytoplasm of excretory cells. The expression starts in the about 100-cell embryo in a few cells in the periphery in the nucleoplasm and in the nucleoli. Complex extrachromosomal arrary....pick Rollers. About 20% Rollers.|"Made_by: Monika Jedrusik"

Proper citation: RRID:WB-STRAIN:WBStrain00006459 Copy   

    • RRID:WB-STRAIN:WBStrain00006458

http://www.wormbase.org/db/get?name=WBStrain00006458

Source Database: WormBase (WB)
Affected Genes: WBGene00001898(his-24)
Genomic Alteration: WBGene00001898(his-24)
Availability: available
Source References: PMID:26024448
Synonyms: eeEx100.
Alternate IDs: WB-STRAIN:EC100, CGC_EC100
Notes: eeEx100 [his-24::GFP + rol-6(su1006)]. Rollers. Nuclear GFP fluorescence detected beginning with the eight-cell stage of the embryo in all somatic nuclei without the P-cell. In adults the GFP signal in somatic cells and in few hermaphrodites in undifferentiated germ nuclei and in oocytes and sperm. About 20% transmission.|"Made_by: Monika Jedrusik"

Proper citation: RRID:WB-STRAIN:WBStrain00006458 Copy   

    • RRID:WB-STRAIN:WBStrain00006455

http://www.wormbase.org/db/get?name=WBStrain00006455

Source Database: WormBase (WB)
Affected Genes: WBGene00001076(dpy-17)|WBGene00003908(pag-1)
Genomic Alteration: WBGene00001076(dpy-17), WBGene00003908(pag-1)
Availability: available
Source References: PMID:8574900
Synonyms: pag-1(ls2) dpy-17(e164) III.
Alternate IDs: WB-STRAIN:EA90, CGC_EA90
Notes: Dpy. pag-1(ls2) is recessive and has not visible phenotype by itself. It increases the expression of certain lacZ fusion genes such as lacZmec-7, unc-86lacZ and unc-4unc-76lacZ.|"Made_by: Guofeng Xie"

Proper citation: RRID:WB-STRAIN:WBStrain00006455 Copy   

    • RRID:WB-STRAIN:WBStrain00006407

http://www.wormbase.org/db/get?name=WBStrain00006407

Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)|WBGene00003134(mat-3)
Genomic Alteration: WBGene00001867(him-8), WBGene00003134(mat-3)
Availability: available
Source References: EMPTY
Synonyms: mat-3(or180) III; him-8(e1489) IV.
Alternate IDs: WB-STRAIN:DS73, CGC_DS73
Notes: Temperature sensitive. Maintain at 15C.

Proper citation: RRID:WB-STRAIN:WBStrain00006407 Copy   

    • RRID:WB-STRAIN:WBStrain00006402

http://www.wormbase.org/db/get?name=WBStrain00006402

Source Database: WormBase (WB)
Affected Genes: WBGene00000912(daf-16)|WBGene00003050(liv-4)|WBGene00004510(rrf-3)
Genomic Alteration: WBGene00000912(daf-16), WBGene00003050(liv-4), WBGene00004510(rrf-3)
Availability: available
Source References: EMPTY
Synonyms: daf-16(m26) I; rrf-3(b26) II; liv-4(m872) V.
Alternate IDs: WB-STRAIN:DR2208, CGC_DR2208
Notes: daf-d on starvation. Sterile at 25C. Maintain at 15C. Mild Unc.

Proper citation: RRID:WB-STRAIN:WBStrain00006402 Copy   

    • RRID:WB-STRAIN:WBStrain00006412

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006412

Source Database: WormBase (WB)
Affected Genes: WBGene00003133(apc-1)
Genomic Alteration: WBGene00003133(apc-1)
Availability: available
Source References: EMPTY
Synonyms: apc-1(ax102) II.
Alternate IDs: WB-STRAIN:DS98, CGC_DS98
Notes: Made_by: Matt Wallenfang|"Temperature sensitive. Maintain at 15C. Formerly known as mat-2."

Proper citation: RRID:WB-STRAIN:WBStrain00006412 Copy   

    • RRID:WB-STRAIN:WBStrain00006411

http://www.wormbase.org/db/get?name=WBStrain00006411

Source Database: WormBase (WB)
Affected Genes: WBGene00003133(apc-1)
Genomic Alteration: WBGene00003133(apc-1)
Availability: available
Source References: EMPTY
Synonyms: apc-1(ax76) II.
Alternate IDs: WB-STRAIN:DS97, CGC_DS97
Notes: Made_by: Matt Wallenfang|"Temperature sensitive. Maintain at 15C. Formerly known as mat-2."

Proper citation: RRID:WB-STRAIN:WBStrain00006411 Copy   

    • RRID:WB-STRAIN:WBStrain00006680

http://www.wormbase.org/db/get?name=WBStrain00006680

Source Database: WormBase (WB)
Affected Genes: WBGene00003553(nas-37)
Genomic Alteration: WBGene00003553(nas-37)
Availability: available
Source References: EMPTY
Synonyms: nas-37(tm410) X.
Alternate IDs: WB-STRAIN:EG3283, CGC_EG3283
Notes: At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Deletion. Flanking sequences: ttcttgtccagtagggtctagtcgtggttg tgaacttgcctgtcgatgtcttctggctga.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00006680 Copy   

    • RRID:WB-STRAIN:WBStrain00006678

http://www.wormbase.org/db/get?name=WBStrain00006678

Source Database: WormBase (WB)
Affected Genes: WBGene00006763(unc-26)
Genomic Alteration: WBGene00006763(unc-26)
Availability: available
Source References: PMID:35065714, PMID:37053235
Synonyms: unc-26(s1710) IV.
Alternate IDs: WB-STRAIN:EG3027, CGC_EG3027
Notes: Severe kinker. Small and scrawny with flaccid little movement. Slow pharyngeal pumping.

Proper citation: RRID:WB-STRAIN:WBStrain00006678 Copy   

    • RRID:WB-STRAIN:WBStrain00006675

http://www.wormbase.org/db/get?name=WBStrain00006675

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: oxEx344.
Alternate IDs: WB-STRAIN:EG2537, CGC_EG2537
Notes: oxEx344 [MosPolyA substrate + myo-2::GFP]. Should be grown at 25C.

Proper citation: RRID:WB-STRAIN:WBStrain00006675 Copy   

    • RRID:WB-STRAIN:WBStrain00006691

http://www.wormbase.org/db/get?name=WBStrain00006691

Source Database: WormBase (WB)
Availability: available
Source References: PMID:33820969, PMID:37221008, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:EG4349, CGC_EG4349
Notes: Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.

Proper citation: RRID:WB-STRAIN:WBStrain00006691 Copy   

    • RRID:WB-STRAIN:WBStrain00006689

http://www.wormbase.org/db/get?name=WBStrain00006689

Source Database: WormBase (WB)
Availability: available
Source References: PMID:33820969, PMID:37865119, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:EG4347, CGC_EG4347
Notes: Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.

Proper citation: RRID:WB-STRAIN:WBStrain00006689 Copy   

    • RRID:WB-STRAIN:WBStrain00006618

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006618

Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3011, CGC_ED3011
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J.|"Made_by: A. Cutter/E. Dolgin"

Proper citation: RRID:WB-STRAIN:WBStrain00006618 Copy   

    • RRID:WB-STRAIN:WBStrain00006617

http://www.wormbase.org/db/get?name=WBStrain00006617

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3010, CGC_ED3010
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A.|"Made_by: A. Cutter/E. Dolgin"

Proper citation: RRID:WB-STRAIN:WBStrain00006617 Copy   

    • RRID:WB-STRAIN:WBStrain00006616

http://www.wormbase.org/db/get?name=WBStrain00006616

Source Database: WormBase (WB)
Availability: available
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3005, CGC_ED3005
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a West Mains allotment public vegetable garden near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.

Proper citation: RRID:WB-STRAIN:WBStrain00006616 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch