Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 466 showing 9301 ~ 9320 out of 147,236 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00022289

http://www.wormbase.org/db/get?name=WBStrain00022289

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; axIs1608.
Alternate IDs: WB-STRAIN:JH2220, CGC_JH2220
Notes: axIs1608 [pie-1p::GFP::histone H2B::par-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt"

Proper citation: RRID:WB-STRAIN:WBStrain00022289 Copy   

    • RRID:WB-STRAIN:WBStrain00022202

http://www.wormbase.org/db/get?name=WBStrain00022202

Source Database: WormBase (WB)
Affected Genes: WBGene00002044(hyl-2)
Genomic Alteration: WBGene00002044(hyl-2)
Availability: available
Source References: EMPTY
Synonyms: hyl-2(gnv1) X.
Alternate IDs: WB-STRAIN:JCM1, CGC_JCM1
Notes: gnv1 was found in strain AT10. hyl-2(+):CATCAT: aagcgcagtgatttctggcaaatgcttgttcatcattttatcaccctcgcacttattgg tgtttca; hyl-2(gnv1): CAATAT: aagcgcagtgatttctggcaaatgcttgttcaatattttatcaccctcgcacttattgg tgtttca. Anoxia sensitive. Heat-shock (36 deg Celcius) sensitive.

Proper citation: RRID:WB-STRAIN:WBStrain00022202 Copy   

    • RRID:WB-STRAIN:WBStrain00022281

http://www.wormbase.org/db/get?name=WBStrain00022281

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; axIs1564.
Alternate IDs: WB-STRAIN:JH2163, CGC_JH2163
Notes: axIs1564 [pie-1p::GFP::fog-2 ORF::fog-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt"

Proper citation: RRID:WB-STRAIN:WBStrain00022281 Copy   

    • RRID:WB-STRAIN:WBStrain00022280

http://www.wormbase.org/db/get?name=WBStrain00022280

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; axIs1563.
Alternate IDs: WB-STRAIN:JH2162, CGC_JH2162
Notes: axIs1563 [pie-1p::GFP::cep-1 ORF::cep-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt"

Proper citation: RRID:WB-STRAIN:WBStrain00022280 Copy   

    • RRID:WB-STRAIN:WBStrain00022273

http://www.wormbase.org/db/get?name=WBStrain00022273

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; axIs1720.
Alternate IDs: WB-STRAIN:JH2107, CGC_JH2107
Notes: axIs1720 [pie-1p::GFP::pgl-1 ORF::pgl-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt"

Proper citation: RRID:WB-STRAIN:WBStrain00022273 Copy   

    • RRID:WB-STRAIN:WBStrain00022226

http://www.wormbase.org/db/get?name=WBStrain00022226

Source Database: WormBase (WB)
Affected Genes: WBGene00000232(avr-14)|WBGene00000233(avr-15)
Genomic Alteration: WBGene00000232(avr-14), WBGene00000233(avr-15)
Availability: available
Source References: EMPTY
Synonyms: avr-14(ad1302) I; avr-15(ad1051) V.
Alternate IDs: WB-STRAIN:JD740, CGC_JD740
Notes: Modest ivermectin resistance. Mild feeding defect. Lacks M3 neurotransmission. Reference: Dent JA, et al. Proc Natl Acad Sci U S A. 2000 Mar 14;97(6):2674-9.

Proper citation: RRID:WB-STRAIN:WBStrain00022226 Copy   

    • RRID:WB-STRAIN:WBStrain00022221

http://www.wormbase.org/db/get?name=WBStrain00022221

Source Database: WormBase (WB)
Affected Genes: WBGene00001517(gar-1)|WBGene00001519(gar-3)
Genomic Alteration: WBGene00001517(gar-1), WBGene00001519(gar-3)
Availability: available
Source References: EMPTY
Synonyms: gar-3(lg1201) V; gar-1(ad1676) X.
Alternate IDs: WB-STRAIN:JD255, CGC_JD255
Notes: Pharyngeal pumping anomalies. Arecoline resistance. Locomotion variant. Reference: Steger KA & Avery L. Genetics. 2004 Jun;167(2):633-43.

Proper citation: RRID:WB-STRAIN:WBStrain00022221 Copy   

    • RRID:WB-STRAIN:WBStrain00022224

http://www.wormbase.org/db/get?name=WBStrain00022224

Source Database: WormBase (WB)
Affected Genes: WBGene00000233(avr-15)|WBGene00001591(glc-1)
Genomic Alteration: WBGene00000233(avr-15), WBGene00001591(glc-1)
Availability: available
Source References: EMPTY
Synonyms: avr-15(ad1051) glc-1(pk54) V.
Alternate IDs: WB-STRAIN:JD600, CGC_JD600
Notes: Slow pumping. This strain is a replacement for the strain DA1370 whose genotype is actually avr-15(vu227) glc-1(pk54) V. Reference: Dent et al., 2000, Proc. Nat. Acad. Sci. 97(6): 2674-2679.

Proper citation: RRID:WB-STRAIN:WBStrain00022224 Copy   

    • RRID:WB-STRAIN:WBStrain00022216

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00022216

Source Database: WormBase (WB)
Affected Genes: WBGene00000367(cca-1)
Genomic Alteration: WBGene00000367(cca-1)
Availability: available
Source References: PMID:37624669
Synonyms: cca-1(ad1650) X.
Alternate IDs: WB-STRAIN:JD21, CGC_JD21
Notes: Mutagen:UV/TMP|"Slow pharyngeal pumping. Abnormal pharyngeal muscle depolarization."|"Supplementary_genotype"

Proper citation: RRID:WB-STRAIN:WBStrain00022216 Copy   

    • RRID:WB-STRAIN:WBStrain00022218

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00022218

Source Database: WormBase (WB)
Affected Genes: WBGene00000233(avr-15)
Genomic Alteration: WBGene00000233(avr-15)
Availability: available
Source References: PMID:31220273
Synonyms: avr-15(ad1051) V.
Alternate IDs: WB-STRAIN:JD105, CGC_JD105
Notes: Reference WBPaper00056919 added based on published strain data identified by Textpresso literature search.|"Starved; feeding defective; lacks M3 neurotransmission. From DA1051. DA1051 has bor-1 in the background. bor-1 has been crossed out in JD105."

Proper citation: RRID:WB-STRAIN:WBStrain00022218 Copy   

    • RRID:WB-STRAIN:WBStrain00022217

http://www.wormbase.org/db/get?name=WBStrain00022217

Source Database: WormBase (WB)
Affected Genes: WBGene00001594(glc-4)
Genomic Alteration: WBGene00001594(glc-4)
Availability: available
Source References: EMPTY
Synonyms: glc-4(ok212) II.
Alternate IDs: WB-STRAIN:JD31, CGC_JD31
Notes: C27H5.8. No obvious phenotype. URL: URL: www.celeganskoconsortium.omrf.org.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00022217 Copy   

    • RRID:WB-STRAIN:WBStrain00022295

http://www.wormbase.org/db/get?name=WBStrain00022295

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; axIs1640.
Alternate IDs: WB-STRAIN:JH2252, CGC_JH2252
Notes: axIs1640 [pie-1p::GFP::histone H2B::glp-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt"

Proper citation: RRID:WB-STRAIN:WBStrain00022295 Copy   

    • RRID:WB-STRAIN:WBStrain00022298

http://www.wormbase.org/db/get?name=WBStrain00022298

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; axIs1654.
Alternate IDs: WB-STRAIN:JH2270, CGC_JH2270
Notes: axIs1654 [pie-1p::GFP::histone H2B::fbf-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt"

Proper citation: RRID:WB-STRAIN:WBStrain00022298 Copy   

    • RRID:WB-STRAIN:WBStrain00022299

http://www.wormbase.org/db/get?name=WBStrain00022299

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; axIs1729.
Alternate IDs: WB-STRAIN:JH2281, CGC_JH2281
Notes: axIs1729 [pie-1p::LAP tag::mCherry::nos-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.|"Made_by: E Voronina"

Proper citation: RRID:WB-STRAIN:WBStrain00022299 Copy   

    • RRID:WB-STRAIN:WBStrain00022214

http://www.wormbase.org/db/get?name=WBStrain00022214

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: jcpSi37 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:JCP405, CGC_JCP405
Notes: jcpSi37 [F08H9.3p::F08H9.3::3xFLAG::eGFP::F08H9.3 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gmez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.|"Made_by: Knudra Nemametrix"

Proper citation: RRID:WB-STRAIN:WBStrain00022214 Copy   

    • RRID:WB-STRAIN:WBStrain00022213

http://www.wormbase.org/db/get?name=WBStrain00022213

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: jcpSi31 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:JCP394, CGC_JCP394
Notes: jcpSi31 [Y75B8A.23p::Y75B8A.23::3xFLAG::eGFP::Y75B8A.2 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gmez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.|"Made_by: Knudra Nemametrix"

Proper citation: RRID:WB-STRAIN:WBStrain00022213 Copy   

    • RRID:WB-STRAIN:WBStrain00022370

http://www.wormbase.org/db/get?name=WBStrain00022370

Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00002297(ect-2)|WBGene00003918(par-3)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00002297(ect-2), WBGene00003918(par-3), WBGene00006768(unc-32)
Availability: available
Source References: EMPTY
Synonyms: ect-2(ax751) II; par-3(it71) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; zuIs45 V.
Alternate IDs: WB-STRAIN:JH2756, CGC_JH2756
Notes: zuIs45 [nmy-2::NMY-2::GFP + unc-119(+)] V. Temperature-sensitive. Maternal-effect lethal at 25 C. Maintain at 15-20 C. Segregates Unc Mel, non-Unc Mel, non-Unc Ste. Reference: Zonies S, et al. Development. 2010 May;137(10):1669-77.

Proper citation: RRID:WB-STRAIN:WBStrain00022370 Copy   

    • RRID:WB-STRAIN:WBStrain00022362

http://www.wormbase.org/db/get?name=WBStrain00022362

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; axIs1844.
Alternate IDs: WB-STRAIN:JH2686, CGC_JH2686
Notes: axIs1844 [GFP::npp-7 + unc-119(+)]. Maintain at 25C to maintain transgene expression.|"Made_by: E Voronina"

Proper citation: RRID:WB-STRAIN:WBStrain00022362 Copy   

    • RRID:WB-STRAIN:WBStrain00022364

http://www.wormbase.org/db/get?name=WBStrain00022364

Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00003796(npp-10)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00003796(npp-10)
Availability: available
Source References: EMPTY
Synonyms: npp-10(ok467)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III.
Alternate IDs: WB-STRAIN:JH2691, CGC_JH2691
Notes: Made_by: G. Sedoux|"qIs26 [lag-2::GFP + rol-6(su1006)]. ok467 deletion balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and npp-10 homozygotes (Emb or early Larval lethal). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain."

Proper citation: RRID:WB-STRAIN:WBStrain00022364 Copy   

    • RRID:WB-STRAIN:WBStrain00022366

http://www.wormbase.org/db/get?name=WBStrain00022366

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; axIs1895.
Alternate IDs: WB-STRAIN:JH2730, CGC_JH2730
Notes: axIs1895 [pie-1p::GFP::H2B::rec-8 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in adult germline; somatic and germline expression in embryos.|"Made_by: Chris Meritt"

Proper citation: RRID:WB-STRAIN:WBStrain00022366 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch