Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 470 showing 9381 ~ 9400 out of 147,236 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00022427

http://www.wormbase.org/db/get?name=WBStrain00022427

Source Database: WormBase (WB)
Affected Genes: WBGene00009977(swan-1)
Genomic Alteration: WBGene00009977(swan-1)
Availability: available
Source References: EMPTY
Synonyms: swan-1(ax2045[V5::swan-1]) V.
Alternate IDs: WB-STRAIN:JH3134, CGC_JH3134
Notes: V5 tag inserted at N-terminus of swan-1. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Proper citation: RRID:WB-STRAIN:WBStrain00022427 Copy   

    • RRID:WB-STRAIN:WBStrain00022420

http://www.wormbase.org/db/get?name=WBStrain00022420

Source Database: WormBase (WB)
Affected Genes: WBGene00012348(pptr-1)
Genomic Alteration: WBGene00012348(pptr-1)
Availability: available
Source References: EMPTY
Synonyms: pptr-1(tm3103) V; axIs2076.
Alternate IDs: WB-STRAIN:JH3064, CGC_JH3064
Notes: axIs2076 [meg-3p::GFP::meg-3::meg-3 3'UTR + unc-119(+)]. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.

Proper citation: RRID:WB-STRAIN:WBStrain00022420 Copy   

    • RRID:WB-STRAIN:WBStrain00022414

http://www.wormbase.org/db/get?name=WBStrain00022414

Source Database: WormBase (WB)
Affected Genes: WBGene00003150(mbk-2)|WBGene00004042(plk-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00003150(mbk-2), WBGene00004042(plk-1), WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: plk-1(ax2002) unc-119(ed3) orIs1 III; mbk-2(dd5) IV.
Alternate IDs: WB-STRAIN:JH3012, CGC_JH3012
Notes: Made_by: Seydoux Lab|"orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41."

Proper citation: RRID:WB-STRAIN:WBStrain00022414 Copy   

    • RRID:WB-STRAIN:WBStrain00022417

http://www.wormbase.org/db/get?name=WBStrain00022417

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:34223818
Synonyms: unc-119(ed3) III; axIs2076.
Alternate IDs: WB-STRAIN:JH3016, CGC_JH3016
Notes: axIs2076 [meg-3p::GFP::meg-3::meg-3 3'UTR + unc-119(+)]. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.|"WBStrain mapped, WBPaper00061596 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00022417 Copy   

    • RRID:WB-STRAIN:WBStrain00022419

http://www.wormbase.org/db/get?name=WBStrain00022419

Source Database: WormBase (WB)
Affected Genes: WBGene00001569(meg-3)
Genomic Alteration: WBGene00001569(meg-3)
Availability: available
Source References: EMPTY
Synonyms: meg-3(tm4259) X.
Alternate IDs: WB-STRAIN:JH3055, CGC_JH3055
Notes: Made_by: S. Mitani & J. Wang|"Mild embryonic P granule defect. Reference: Wang JT, et al. eLife 2014;3:e04591."|"Mutagen:TMP+UV"|"Mutagen:TMP/UV"

Proper citation: RRID:WB-STRAIN:WBStrain00022419 Copy   

    • RRID:WB-STRAIN:WBStrain00022496

http://www.wormbase.org/db/get?name=WBStrain00022496

Source Database: WormBase (WB)
Affected Genes: WBGene00003921(par-6)|WBGene00006829(unc-101)
Genomic Alteration: WBGene00003921(par-6), WBGene00006829(unc-101)
Availability: available
Source References: EMPTY
Synonyms: par-6(zu222) unc-101(m1); zuIs54.
Alternate IDs: WB-STRAIN:JJ1578, CGC_JJ1578
Notes: zuIs54 [par-6p::par-6::ZF1::GFP + unc-119(+)]. Unc. GFP-tagged PAR-6 that degrades in early embryonic somatic cells; rescues the Par phenotype of par-6(zu222). Delayed gastrulation of endodermal cells. Reference: Nance J, Munro EM, Priess JR. Development. 2003 Nov;130(22):5339-50.

Proper citation: RRID:WB-STRAIN:WBStrain00022496 Copy   

    • RRID:WB-STRAIN:WBStrain00022495

http://www.wormbase.org/db/get?name=WBStrain00022495

Source Database: WormBase (WB)
Affected Genes: WBGene00001061(dpl-1)|WBGene00002299(let-23)|WBGene00004397(rol-6)|WBGene00006744(unc-4)
Genomic Alteration: WBGene00001061(dpl-1), WBGene00002299(let-23), WBGene00004397(rol-6), WBGene00006744(unc-4)
Availability: available
Source References: EMPTY
Synonyms: dpl-1(zu355) unc-4(e120)/rol-6(e187) let-23(sy97) II.
Alternate IDs: WB-STRAIN:JJ1550, CGC_JJ1550
Notes: Heterozygotes are WT and segregate WT, Uncs which give only deads egss with a Mex phenotype, and Vulvaless Rollers. sy97 is only 15% viable.

Proper citation: RRID:WB-STRAIN:WBStrain00022495 Copy   

    • RRID:WB-STRAIN:WBStrain00022498

http://www.wormbase.org/db/get?name=WBStrain00022498

Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)|WBGene00003921(par-6)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001867(him-8), WBGene00003921(par-6), WBGene00006789(unc-54)
Availability: available
Source References: PMID:39652540
Synonyms: par-6(tm1425)/hIn1 [unc-54(h1040)] I; him-8(e1489) IV.
Alternate IDs: WB-STRAIN:JJ1743, CGC_JJ1743
Notes: Heterozygotes are WT and segregate WT, Uncs, dead larvae (par-6 homozygotes) and males.

Proper citation: RRID:WB-STRAIN:WBStrain00022498 Copy   

    • RRID:WB-STRAIN:WBStrain00022497

http://www.wormbase.org/db/get?name=WBStrain00022497

Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)|WBGene00003055(lon-1)|WBGene00003918(par-3)
Genomic Alteration: WBGene00001867(him-8), WBGene00003055(lon-1), WBGene00003918(par-3)
Availability: available
Source References: EMPTY
Synonyms: par-3(it71) lon-1(e185) III; him-8(e1489) IV; zuIs20.
Alternate IDs: WB-STRAIN:JJ1600, CGC_JJ1600
Notes: zuIs20 [par-3p::par-3::ZF1::GFP + unc-119(+)]. Lon. Him. GFP-tagged PAR-3 that is degraded in early embryonic somatic cells. Rescues the Par phenotype of par-3(it71). Delayed endodermal cell gastrulation. Reference: Nance J, Munro EM, Priess JR. Development. 2003 Nov;130(22):5339-50.

Proper citation: RRID:WB-STRAIN:WBStrain00022497 Copy   

    • RRID:WB-STRAIN:WBStrain00022411

http://www.wormbase.org/db/get?name=WBStrain00022411

Source Database: WormBase (WB)
Affected Genes: WBGene00003150(mbk-2)|WBGene00009507(mus-101)
Genomic Alteration: WBGene00003150(mbk-2), WBGene00009507(mus-101)
Availability: available
Source References: EMPTY
Synonyms: mus-101(ax2011) I; mbk-2(dd5) IV.
Alternate IDs: WB-STRAIN:JH3006, CGC_JH3006
Notes: Made_by: Seydoux Lab|"Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41."

Proper citation: RRID:WB-STRAIN:WBStrain00022411 Copy   

    • RRID:WB-STRAIN:WBStrain00022499

http://www.wormbase.org/db/get?name=WBStrain00022499

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006768(unc-32)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) I; unc-32(e189) III.
Alternate IDs: WB-STRAIN:JJ1833, CGC_JJ1833
Notes: Dpy Unc.

Proper citation: RRID:WB-STRAIN:WBStrain00022499 Copy   

    • RRID:WB-STRAIN:WBStrain00022447

http://www.wormbase.org/db/get?name=WBStrain00022447

Source Database: WormBase (WB)
Affected Genes: WBGene00010677(gtbp-1)
Genomic Alteration: WBGene00010677(gtbp-1)
Availability: available
Source References: EMPTY
Synonyms: gtbp-1(ax2053[gtbp-1::GFP]) IV.
Alternate IDs: WB-STRAIN:JH3197, CGC_JH3197
Notes: Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1 between IV: 10127266...10127267. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Proper citation: RRID:WB-STRAIN:WBStrain00022447 Copy   

    • RRID:WB-STRAIN:WBStrain00022446

http://www.wormbase.org/db/get?name=WBStrain00022446

Source Database: WormBase (WB)
Affected Genes: WBGene00003150(mbk-2)
Genomic Alteration: WBGene00003150(mbk-2)
Availability: available
Source References: EMPTY
Synonyms: mbk-2(ax2051[V5::mbk-2]) IV.
Alternate IDs: WB-STRAIN:JH3195, CGC_JH3195
Notes: V5 tag inserted at the N-terminus of mbk-2 isoform a. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Proper citation: RRID:WB-STRAIN:WBStrain00022446 Copy   

    • RRID:WB-STRAIN:WBStrain00022449

http://www.wormbase.org/db/get?name=WBStrain00022449

Source Database: WormBase (WB)
Affected Genes: WBGene00001402(fbf-2)
Genomic Alteration: WBGene00001402(fbf-2)
Availability: available
Source References: EMPTY
Synonyms: fbf-2(ax2057[fbf-2::GFP]) II.
Alternate IDs: WB-STRAIN:JH3201, CGC_JH3201
Notes: Maintain at 20-25C. ax2057 was produced by mutation of the sgRNA site and insertion of GFP cDNA at the C-terminus of fbf-2. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of fbf-2: ATCATCGCCGTGACTACCA(GFP) between II:6089145...6089165. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Proper citation: RRID:WB-STRAIN:WBStrain00022449 Copy   

    • RRID:WB-STRAIN:WBStrain00022448

http://www.wormbase.org/db/get?name=WBStrain00022448

Source Database: WormBase (WB)
Affected Genes: WBGene00010677(gtbp-1)
Genomic Alteration: WBGene00010677(gtbp-1)
Availability: available
Source References: EMPTY
Synonyms: gtbp-1(ax2055[gtbp-1::GFP]) IV.
Alternate IDs: WB-STRAIN:JH3199, CGC_JH3199
Notes: Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1: ATTTTGTCCCGCATTTTGGAAACCGCTACGCATTCCTCCACGC(GFP) between IV: 10127239-10127283. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Proper citation: RRID:WB-STRAIN:WBStrain00022448 Copy   

    • RRID:WB-STRAIN:WBStrain00022443

http://www.wormbase.org/db/get?name=WBStrain00022443

Source Database: WormBase (WB)
Affected Genes: WBGene00003230(mex-5)
Genomic Alteration: WBGene00003230(mex-5)
Availability: available
Source References: EMPTY
Synonyms: mex-5(ax2041[3xFLAG::mex-5]) IV.
Alternate IDs: WB-STRAIN:JH3188, CGC_JH3188
Notes: Maintain at 20C. 3xFLAG-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Proper citation: RRID:WB-STRAIN:WBStrain00022443 Copy   

    • RRID:WB-STRAIN:WBStrain00022445

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00022445

Source Database: WormBase (WB)
Affected Genes: WBGene00003784(nos-2)
Genomic Alteration: WBGene00003784(nos-2)
Availability: available
Source References: EMPTY
Synonyms: nos-2(ax2049[3XFLAG::nos-2]) II.
Alternate IDs: WB-STRAIN:JH3193, CGC_JH3193
Notes: Made_by: Chih-Yung Lee|"Maintain at 20C. FLAG::NOS-2 can be detected from P4 to Z2/Z3 stage. Reference: Paix A, et al. Genetics. 2014 Sep 23."

Proper citation: RRID:WB-STRAIN:WBStrain00022445 Copy   

    • RRID:WB-STRAIN:WBStrain00022444

http://www.wormbase.org/db/get?name=WBStrain00022444

Source Database: WormBase (WB)
Affected Genes: WBGene00003230(mex-5)
Genomic Alteration: WBGene00003230(mex-5)
Availability: available
Source References: EMPTY
Synonyms: mex-5(ax2043[OLLAS::mex-5]) IV.
Alternate IDs: WB-STRAIN:JH3190, CGC_JH3190
Notes: Maintain at 20C. OLLAS-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Proper citation: RRID:WB-STRAIN:WBStrain00022444 Copy   

    • RRID:WB-STRAIN:WBStrain00022437

http://www.wormbase.org/db/get?name=WBStrain00022437

Source Database: WormBase (WB)
Affected Genes: WBGene00009976(swan-2)|WBGene00009977(swan-1)
Genomic Alteration: WBGene00009976(swan-2), WBGene00009977(swan-1)
Availability: available
Source References: EMPTY
Synonyms: swan-1&swan-2(ax2072) V.
Alternate IDs: WB-STRAIN:JH3159, CGC_JH3159
Notes: Deletion of the operon CEOP 5400, removing both swan-1 and swan-2 (V: 13801629-13807223). No reported phenotype. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Proper citation: RRID:WB-STRAIN:WBStrain00022437 Copy   

    • RRID:WB-STRAIN:WBStrain00022433

http://www.wormbase.org/db/get?name=WBStrain00022433

Source Database: WormBase (WB)
Affected Genes: WBGene00001569(meg-3)
Genomic Alteration: WBGene00001569(meg-3)
Availability: available
Source References: EMPTY
Synonyms: meg-3(tm4259) X; axIs2076.
Alternate IDs: WB-STRAIN:JH3153, CGC_JH3153
Notes: axIs2076 [meg-3p::GFP::meg-3::meg-3 3'UTR + unc-119(+)]. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.

Proper citation: RRID:WB-STRAIN:WBStrain00022433 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch