Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00036342
Source Database: WormBase (WB)
Affected Genes: WBGene00003710(nhr-120)
Genomic Alteration: WBGene00003710(nhr-120)
Availability: available
Synonyms: nhr-120(gk519) X.
Alternate IDs: WB-STRAIN:VC1122, CGC_VC1122
Notes: C25B8.6. Superficially wild type.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036342 Copy
http://www.wormbase.org/db/get?name=WBStrain00036345
Source Database: WormBase (WB)
Affected Genes: WBGene00016354(rig-6)
Genomic Alteration: WBGene00016354(rig-6)
Availability: available
Synonyms: rig-6(ok1589) II.
Alternate IDs: WB-STRAIN:VC1125, CGC_VC1125
Notes: C33F10.5. Superficially wild type. External left primer: GAGCCGTTTTAACCCAATCA. External right primer: TAATTTTCAGAACCGTCGGG. Internal left primer: ACGTTCTGCTGCTCTCCATT. Internal right primer: GCAACCAACTCCTTCCATTC. Internal WT amplicon: 3304 bp. Deletion size: 1554 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036345 Copy
http://www.wormbase.org/db/get?name=WBStrain00036344
Source Database: WormBase (WB)
Affected Genes: WBGene00000092(ags-3)|WBGene00017973(ift-81)
Genomic Alteration: WBGene00000092(ags-3), WBGene00017973(ift-81)
Availability: available
Synonyms: ags-3&F32A6.2(gk517) X.
Alternate IDs: WB-STRAIN:VC1124, CGC_VC1124
Notes: F32A6.4, F32A6.2. Superficially wild type.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036344 Copy
http://www.wormbase.org/db/get?name=WBStrain00036346
Source Database: WormBase (WB)
Affected Genes: WBGene00008238(C50F4.16)
Genomic Alteration: WBGene00008238(C50F4.16)
Availability: available
Synonyms: C50F4.16(gk518) V.
Alternate IDs: WB-STRAIN:VC1126, CGC_VC1126
Notes: C50F4.16. Superficially wild type.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036346 Copy
http://www.wormbase.org/db/get?name=WBStrain00036349
Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00016422(noah-1)
Genomic Alteration: WBGene00003056(lon-2), WBGene00016422(noah-1)
Availability: available
Synonyms: noah-1(ok1587)/szT1 [lon-2(e678)] I; +/szT1 X.
Alternate IDs: WB-STRAIN:VC1129, CGC_VC1129
Notes: C34G6.6. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1587 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAGCAGATGAATCGAAACGG. External right primer: CTCGAGACAAGCCAATGTCA. Internal left primer: TCTTCACAGCCGATGACTTG. Internal right primer: CAATGAAGGTCTTTGCGGTT. Internal WT amplicon: 3308 bp. Deletion size: 2455 bp. Deletion left flank: TCACAGCCGATGACTTGATTTCAATAGCTC. Deletion right flank: TGAGAGTATACAATTTTGAAATATATTTTC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036349 Copy
http://www.wormbase.org/db/get?name=WBStrain00036348
Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00021648(mis-12)|WBGene00021649(Y47G6A.25)
Genomic Alteration: WBGene00003056(lon-2), WBGene00021648(mis-12), WBGene00021649(Y47G6A.25)
Availability: available
Synonyms: mis-12&Y47G6A.25(ok1536)/szT1 [lon-2(e678)] I; +/szT1 X.
Alternate IDs: WB-STRAIN:VC1128, CGC_VC1128
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y47G6A.24, Y47G6A.25. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1536 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain."
Proper citation: RRID:WB-STRAIN:WBStrain00036348 Copy
http://www.wormbase.org/db/get?name=WBStrain00036351
Source Database: WormBase (WB)
Affected Genes: WBGene00004384(rnp-1)
Genomic Alteration: WBGene00004384(rnp-1)
Availability: available
Synonyms: rnp-1(ok1549) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC1131, CGC_VC1131
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK863.7. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1549 homozygotes (sterile Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain."
Proper citation: RRID:WB-STRAIN:WBStrain00036351 Copy
http://www.wormbase.org/db/get?name=WBStrain00036317
Source Database: WormBase (WB)
Affected Genes: WBGene00020425(syx-18)
Genomic Alteration: WBGene00020425(syx-18)
Availability: available
Synonyms: T10H9.3(ok1546) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC1090, CGC_VC1090
Notes: Mutagen:UV/TMP|"T10H9.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1546 homozygotes (arrest stage/phenotype undetermined). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036317 Copy
http://www.wormbase.org/db/get?name=WBStrain00036319
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00008877(rtcb-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00008877(rtcb-1)
Availability: available
Source References: PMID:33157031
Synonyms: rtcb-1(gk451) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1094, CGC_VC1094
Notes: F16A11.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk451 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. May also segregate Bli non-GFP (hT2 homozygotes), which are the result of rare recombination. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCCTTCTTCATCAATTCC. External right primer: ATAATTTCTCGGACCCGCTT. Internal left primer: GCGTAATGATTTCCTGCTCC. Internal right primer: CATCATCTTTCCACCACACG. Internal WT amplicon: 1913 bp. Deletion size: 370 bp. Deletion left flank: ATGATTCACTAACCGAATGTCCAACAATTC. Deletion right flank: ATCTCAAAATCTTTAGTCAAGAAAACATTC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00036319 Copy
http://www.wormbase.org/db/get?name=WBStrain00036310
Source Database: WormBase (WB)
Affected Genes: WBGene00001425(fis-2)
Genomic Alteration: WBGene00001425(fis-2)
Availability: available
Synonyms: fis-2(gk414) X.
Alternate IDs: WB-STRAIN:VC1083, CGC_VC1083
Notes: F13B9.8a. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036310 Copy
http://www.wormbase.org/db/get?name=WBStrain00036397
Source Database: WormBase (WB)
Affected Genes: WBGene00001813(haf-3)
Genomic Alteration: WBGene00001813(haf-3)
Availability: available
Synonyms: haf-3(gk549) V.
Alternate IDs: WB-STRAIN:VC1186, CGC_VC1186
Notes: F57A10.3. Superficially wild type. External left primer: AACCGGTTCTTGTCCAACTG. External right primer: CTACACCTCCCTGGCAATGT. Internal left primer: ACGACGCCAATATGATGGAT. Internal right primer: GAACGTCTTTCTTCCGTTCG. Internal WT amplicon: 1973 bp. Deletion size: 1141 bp. Deletion left flank: TTTTTTAATAAGTTTAATCACATTTTTCGG. Deletion right flank: GTAATTTCTCTTTTTTTTTAAAAAGACTTT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036397 Copy
http://www.wormbase.org/db/get?name=WBStrain00036312
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001039(dnj-21)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001039(dnj-21)
Availability: available
Synonyms: dnj-21(ok1577) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1085, CGC_VC1085
Notes: Mutagen:UV/TMP|"T19B4.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1577 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036312 Copy
http://www.wormbase.org/db/get?name=WBStrain00036316
Source Database: WormBase (WB)
Affected Genes: WBGene00003368(mkk-4)
Genomic Alteration: WBGene00003368(mkk-4)
Availability: available
Synonyms: mkk-4(ok1545) X.
Alternate IDs: WB-STRAIN:VC1089, CGC_VC1089
Notes: F42G10.2. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036316 Copy
http://www.wormbase.org/db/get?name=WBStrain00037868
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00006829(unc-101)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00006829(unc-101)
Availability: available
Synonyms: Y18D10A.9(gk5013[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hIn1[unc-101(sy241)] I .
Alternate IDs: WB-STRAIN:VC3986, CGC_VC3986
Notes: Made_by: Vancouver KO Group|"Recessive lethal deletion balanced by hIn1. Deletion of 4986 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAAATTTCGGATTCGGGTTCCATGCCA; Right flanking sequence: GTCTGAAAATTGAAAATAAATTTAAAAACT. See WormBase Variation gk5013 for details."
Proper citation: RRID:WB-STRAIN:WBStrain00037868 Copy
http://www.wormbase.org/db/get?name=WBStrain00037901
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00020485(ceh-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00020485(ceh-54)
Availability: available
Synonyms: ceh-54(gk5138[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC4064, CGC_VC4064
Notes: Homozygous viable. Deletion of 3125 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTATTCTGGAAATCGGCAAAAAACCAGTT ; Right flanking sequence: GTATAGATAATGCGCTTATTCAAAGTGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037901 Copy
http://www.wormbase.org/db/get?name=WBStrain00037869
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: PMID:37355092
Synonyms: H04D03.3(gk5060[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III.
Alternate IDs: WB-STRAIN:VC3988, CGC_VC3988
Notes: Homozygous viable. Deletion of 2070 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTCCGATTTAAAACTGTCTCTTCCTCTA; Right flanking sequence: CTGGTCATGTTTTTCGAATATTCCACAATT. See WormBase Variation gk5060 for details.|"Made_by: Vancouver KO Group"|"Supplementary_genotype (H04D03.3(gk5060 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) III)"
Proper citation: RRID:WB-STRAIN:WBStrain00037869 Copy
http://www.wormbase.org/db/get?name=WBStrain00037863
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009385(sas-5)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009385(sas-5)
Availability: available
Synonyms: +/nT1 IV; sas-5(gk5038[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V.
Alternate IDs: WB-STRAIN:VC3975, CGC_VC3975
Notes: Made_by: Vancouver KO Group|"Recessive lethal deletion balanced by nT1. Deletion of 1442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCAGCTTCCACAAGAAAGGACAAAACCCC; Right flanking sequence: GGTACCTGAGACTCCAGCTGAACGAGAACG. See WormBase Variation gk5038 for details."
Proper citation: RRID:WB-STRAIN:WBStrain00037863 Copy
http://www.wormbase.org/db/get?name=WBStrain00037860
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Synonyms: Y69A2AR.32(gk5043[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Alternate IDs: WB-STRAIN:VC3967, CGC_VC3967
Notes: Homozygous viable. Deletion of 1554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCGAAACAATGATAATTATCACGATCAAC; Right flanking sequence: CTGATGTCCACTCCGATGCCGCCTCCAGGA. See WormBase Variation gk5043 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037860 Copy
http://www.wormbase.org/db/get?name=WBStrain00037861
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00007591(zipt-13)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00007591(zipt-13)
Availability: available
Synonyms: zipt-13(gk5051[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC3973, CGC_VC3973
Notes: Homozygous viable. Deletion of 2219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTGTCAGAGCAATGTTGAGAAATCCTCCT; Right flanking sequence: GTCCTTGTTGAGCATGTATCGCAATGCAAG. See WormBase Variation gk5051 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037861 Copy
http://www.wormbase.org/db/get?name=WBStrain00037866
Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00016412(mrps-26)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00016412(mrps-26)
Availability: available
Synonyms: mrps-26(gk5010[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III.
Alternate IDs: WB-STRAIN:VC3983, CGC_VC3983
Notes: Made_by: Vancouver KO Group|"Recessive lethal deletion balanced by qC1. Deletion of 993 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGGACGATGTCTTTTGGCATCTGCCATGTC; Right flanking sequence: GGACATGATGTGAGTTATTTTTGAACATCG. See WormBase Variation gk5010 for details."
Proper citation: RRID:WB-STRAIN:WBStrain00037866 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
